Table 2: Nucleotide sequences of primers for miRNA qPCR.

miRNAPrimerSequence

miRNA15aRTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC CACAAAC
FGGCTAGCAGCACATAATGG
miRNA29bRTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC AACACTG
FGGCTAGCACCATTTGAAATC
miRNA28-3pRTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC TCCAGG
FGCGCACTAGATTGTGAGCT
miRNA223 RTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC TGGGGT
FGGCCTGTCAGTTTGTCAAA
miRNA126RTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGCATT
FGCGTCGTACCGTGAGTAAT
miR238RTGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCTGAA
FAGCCTTTGTACTCCGATGC
HasmirRRGTGCGTGTCGTGGAGTC