Table 1: Primer sequences and expected amplicon sizes for the gene amplification.

cDNA
Genbank acc. no.Forward primer (5′ to 3′)Reverse primer (5′ to 3′)Amplicon size (bp)

Cu-ZnSOD
X05634
GCAGAAGGCAAGCGGTGAACTAGCAGGACAGCAGATGAGT387
GPx
NM030826
CTCTCCGCGGTGGCACAGTCCACCACCGGGTCGGACATAC297
CAT
NM012520ACAACTCCCAGAAGCCTAAGAATGGCTTTTCCCTTGGCAGCTATG
76
rOat3
NM031332
ATCTCATCAACATCTATTGGGTACTGCAGAGAGAGACAGAAGGTCACAC371
β-actinNM031144ATGGTGGGTATGGGTCAGAAGGGGTGTTGAAGGTCTCAAA241

Cu-ZnSOD; copper-zinc superoxide dismutase, GPx; glutathione peroxidase, CAT; catalase, rOat3; rat organic anion transporter 3.