Table 1: Primers in the multiplex PCR for the detection of C. difficile.

TargetPrimerSequence ( )Primer concentration ( M)Amplicon size (bp)

tcdA tcdA-FGTATGGATAGGTGGAGAAGTCAGTG0.025
tcdA-RCGGTCTAGTCCAATAGAGCTAGGTC0.025 632
tcdB tcdB-FGAAGATTTAGGAAATGAAGAAGGTGA0.01
tcdB-RAACCACTATATTCAACTGCTTGTCC0.01 441
cdtA cdtA-FATGCACAAGACTTACAAAGCTATAGTG0.2
cdtA-RCGAGAATTTGCTTCTATTTGATAATC0.2 260
cdtB cdtB-FATTGGCAATAATCTATCTCCTGGA0.5
cdtB-RCCAAAATTTCCACTTACTTGTGTTG0.5 179
16s rDNA UFU-LGCCTAACACATGCAAGTCGA0.025
UR802TACCAGGGTATCTAATCC0.025 800