Table 1: International consensus gene set used for C. albicans MLST analysis.

Locus ChromosomeGene productPrimers Sequenced fragment size (bp)

CaAAT1a 2Aspartate aminotransferaseF: ACTCAAGCTAGATTTTTGGC 349
R: CAGCAACATGATTAGCCC
CaACC1 RAcetyl-coenzyme A carboxylaseF: GCAAGAGAAATTTTAATTCAATG 407
R: TTCATCAACATCATCCAAGTG
CaADP1 1ATP-dependent permeaseF: GAGCCAAGTATGAATGATTTG 443
R: TTGATCAACAAACCCGATAAT
CaPMIb 2Mannose phosphate isomeraseF: ACCAGAAATGGCCATTGC 375
R: GCAGCCATGCATTCAATTAT
CaSYA1 6Alanyl-RNA synthetaseF: AGAAGAATTGTTGCTGTTACTG 391
R: GTTACCTTTACCACCAGCTTT
CaVPS13 4Vacuolar protein sorting protein F: TCGTTGAGAGATATTCGACTT 403
R: ACGGATGGATCTCCAGTCC
CaZWF1b 1Glucose-6-phosphate dehydrogenaseF: GTTTCATTTGATCCTGAAGC 491
R: GCCATTGATAAGTACCTGGAT

F and R indicate forward and reverse primers, respectively.