Table 2: Summary of loci used for individual MLST schemes. Data for C. dubliniensis, C. glabrata, C. krusei, and C. tropicalis are from McManus et al. [50], Dodgson et al. [42], Jacobsen et al. [51], and Tavanti et al. [52], respectively.

SpeciesLocusGene productPrimersSequenced fragment size (bp)Genotypes/site

C. dubliniensis CdAAT1a Aspartate aminotransferaseF: ATCAAACTACTAAATTTTTGAC3731.25
R: CGGCAACATGATTAGCCC
CdACC1 Acetyl-coenzyme A carboxylaseF: GCCAGAGAAATTTTGATCCAATGT4071.33
R: TTCATCAACATCATCCAAGTG
CdADP1 ATP-dependent permeaseF: GAGCCAAGTATGAATGACTTG4431.2
R: TTGATCAACAAACCCGATAAT
CdPMIb Mannose phosphate isomeraseF: ACCAGAAATGGCC3753.5
R: GCAGCCATACATTCAATTAT
CdRPN2 26S proteasome regulatory subunitF: TTTATGCATGCTGGTACTACTGATG3021
R: TAACCCCATACTCAAAGCAGCAGCCT
CdSYA1 Alanyl-RNA synthetaseF: AGAAGAATAGTTGCTCTTACTG3911
R: GTTGCCCTTACCACCAGCTTT
CdVPS13 Vacuolar protein sorting 13F: CGTTGAGAGATATTCGACTT4031.33
R: ACGGATCGATCGCCAATCC
CdZWF1b Glucose-6-phosphate dehydrogenaseF: GTTTCATTTGATCCTGAAGC4910.86
R: GCCATTGATAAGTACCTGGAT

C. glabrata CgFKS 1,3- -glucan synthaseF: GTCAAATGCCACAACAACAACCT5891.27
R: AGCACTTCAGCAGCGTCTTCAG
CgLEU2 3-Isopropylmalate dehydrogenaseF: TTTCTTGTATCCTCCCATTGTTCA5121
R: ATAGGTAAAGGTGGGTTGTGTTGC
CgNMT1 Myristoyl-coenzyme A, protein N-myristoyltransferaseF: GCCGGTGTGGTGTTGCCTGCTC6070.81
R: CGTTACTGCGGTGCTCGGTGTCG
CgTRP1 Phosphoribosyl-anthranilate isomeraseF: AATTGTTCCAGCGTTTTTGT4191.08
R: GACCAGTCCAGCTCTTTCAC
CgUGP1 UTP-glucose-1-phosphate uridylyltransferaseF: TTTCAACACCGACAAGGACACAGA6160.75
R: TCGGACTTCACTAGCAGCAAATCA
CgURA3 Orotidine-5′-phosphate decarboxylaseF: AGCGAATTGTTGAAGTTGGTTGA6020.68
R: AATTCGGTTGTAAGATGATGTTGC

C. krusei CkADE2 Phosphoribosylaminoimidazole carboxylaseF: GTCACTTCTCAGTTTGAAGC4702.33
R: ACACCATCTAAAGTAGAGCC
CkHIS3 Imidazole glycerol phosphate dehydrataseF: GGAGGGGACATATCACTGCC4001.75
R: AATCTTTAATTGCCAAAGCC
CkLEU2 3-Isopropylmalate dehydrogenaseF: CTGTGAGACCAGAACAGGGG6191.89
R: GCAGAGCCACCCAAGTCTCC
CkLYS2 L-Aminoadipate-semialdehyde dehydrogenaseF: ATCTGAGAAGCAGTTGGCGC4411.90
R: AGACTTGTAAGAATTATCCC
CkNMT1 Myristoyl-coenzyme A, protein N-myristoyltransferaseF: CTGATGAAGAAATCACCG5372.00
R: GCTTGATATCATCTTTGTCC
CkTRP1 Phosphoribosyl-anthranilate isomeraseF: AGCTATGTCGAGCAAAGAGG3802.00
R: ACATCAACGCCACAACACCC

C. tropicalis CtICL1 Isocitrate lyaseF: CAACAGATTGGTTGCCATCAGAGC4470.71
R: CGAAGTCATCAACAGCCAAAGCAG
CtMDR1 Multidrug resistance proteinF: TGTTGGCATTCACCCTTCCT4251.67
R: TGGAGCACCAAACAATGGGA
CtSAPT2 Secreted aspartic protease 2F: CAACGATCGTGGTGCTG5250.51
R: CACTGGTAGCTGAAGGAG
CtSAPT4 Secreted aspartic protease 4F: TGCTTCTCCTACAACTTCACCTCC3900.90
R: ATTCCCATGACTCCCTGAGCAACA
CtXYR1 D-xylose reductase I or IIF: AGTTGGTTTCGGATGTTG3703.00
R: TCGTAAATCAAAGCACCAGT
CtZWF1 Glucose-6-phosphate dehydrogenaseF: GGTGCTTCAGGAGATTTAGC5200.94
R: ACCTTCAGTACCAAAAGCTTC

F and R indicate forward and reverse primers, respectively. Genotypes/site indicate the ratio of genotypes to SNPs.