Table 3: Description of SSRs used for MLPs analysis of C. albicans.

LocusChGene productRepeat motifLocationDPPrimersReferences

1EF3 5Elongation factor 3(TTC) (TTTC) Upstream region

F: TTTCCTCTTCCTTTCATATAGAA
R: GGATTCACTAGCAGCAGACA
[59, 60, 64, 69, 73]
2ERK1 4Extracellular-signal-regulated kinase(CAGGCT) (CAAGCT)
(CAA) (GCCGCA)
(CTT)
Coding region nrF: CGACCACGTCATCAATAGAAATCG
R: CGTTGAATGAAACTTGACGAGGGG
[64, 70]
3CARE-BEME6nc(GAA) Noncoding region F: GAATCATGAAACAGAAACTG
R: TGGGTGAAGGATAATCTGCA
[72, 73]
4CDC3 1Cell division cycle protein(AGTA) Downstream region
F: CAGATGATTTTTTGTATGAGAAGAA
R: CAGTCACAAGATTAAAATGTTCAAG
[60, 73]
5HIS3 2Imidazole glycerol phosphate dehydratase(ATTT) Downstream region
F: TGGCAAAAATGATATTCCAA
R: TACACTATGCCCCAAACACA
[60, 73]
6KRE6 3 -1,6-Glucan synthesis(AAT) Coding region F: CAAGCTTATAGTGGCTACTA
R: CCAACACTGATACATCTCG
[64, 73]
7LOC4
(MRE11)
7Double-strand break repair protein(GAA) Coding region F: GTAATGATTACGGCAATGAC
R: AGAACGACGTGTACTATTGG
[64, 73]
8ZNF1 4Zinc finger transcription factor(CAA) Coding region F: CCATTACAGCTGAACCAGCGAGGG
R: CGCTAGGTAACCTACAGATTGTGGC
[64, 73]
9CAI4nc(CAA) (CAA) Noncoding region

F: ATGCCATTGAGTGGAATTGG
R: AGTGGCTTGTGTTGGGTTTT
[44, 66, 73]
10CAIII5nc(GAA) Noncoding region

F: TTGGAATCACTTCACCAGGA
R: TTTCCGTGGCATCAGTATCA
[44, 73]
11CAV3nc(ATT) Noncoding region
F: TGCCAAATCTTGAGATACAAGTG
R: CTTGCTTCTCTTGCTTTAAATTG
[44, 73]
12CAVI2nc(TAAA) Noncoding region
F: ACAATTAAAGAAATGGATTTTAGTCAG
R: TGCTGGTGCTGCTGGTATTA
[44]
13CAVII1nc(CAAAT) Noncoding region
F: GGGGATAGAAATGGCATCAA
R: TGTGAAACAATTCTCTCCTTGC
[44, 73]

Discriminatory power (DP) based on one or various loci is indicated in brackets according to the row number. Dashed line indicates various nucleotides that separate different microsatellites in the sequence. Ch: chromosome; nc: not corresponding; nr: not reported.