Table 1: Primers and probe used for LAMP of the IS6110 gene of MTB.

Primer nameGenome positionSequences 5′-3′

F3581-597GCCAGATGCACCGTCGA
B3759-740GACACATAGGTGAGGTCTGC
FIP (F1c/TTTT/F2)664-646/TTTT/604-623AGCGATCGTGGTCCTG CGG-TTTT-
GATGACCAAACTCGGCCTGT
BIP (B1c/TTTT/B2)682-699/TTTT/738-721TCCCGCCGATCTCGTCCA-TTTTT-
ACCCACAGCCGGTTAGGT
FITC-Probe665-680ATCCGGCCACAGCCC