Table 1: Sequences of the specific primers used in the quantitative PCR analyses.

Target mRNA PCR primer sequence 5′–3′
ForwardReverse

18S rRNACGAACGTCTGCCCTATCAACTT ACCCGTGGTCACCATGGTA
IGF-1EaAAGCCTACAAAGTCAGCTCGTCAAGTGTACTTCCTTCTGAGTC
myostatinGGTCCCGGAGAGACTTTGGCGACAGCACCGCGATTC
-skeletal actinCGACATCGACATCAGGAAGGAGGTAGTGCCCCCTGACATGA
MuRF-1TGCCCCCTTACAAAGCATCTTCAGCATGGAGATGCAATTGC
MAFbxTGAAGACCGGCTACTGTGGAA CGGATCTGCCGCTCTGA

PCR: polymerase chain reaction, IGF-1Ea: insulin-like growth factor 1Ea, MuRF-1: muscle ring finger 1, MAFbx: muscle atrophy F-box.