Table 1: Forward and reverse primers sequences used in RT-PCR.

Primer 5′-3′ sequence (forward; reverse)

NT For: AATGTTTGCAGCCTCATAAATAAC
Rev: TGCCAACAAGGTCGTCATC
NTR1 For: GGCAATTCCTCAGAATCCATCC
Rev: ATACAGCGGTCACCAGCAC
NTR2 For: GCCATTACTAACAGTCTAAGC
Rev: GCAATTCGTCCTATTCTACAC
NTR3 For: ATGGCACAACTTCCTTCTG
Rev: AGAGACTTGGAGTAGACAATG
IL-6 For: TTCCATCCAGTTGCCTTC
Rev: TTCTCATTTCCACGATTTCC
TNF-αFor: CAAGGGACTAGCCAGGAG
Rev: TGCCTCTTCTGCCAGTTC
Il-10 For: CCCTTTGCTATGGTGTCCTTTC
Rev: ATCTCCCTGGTTTCTCTTCCC
IL-1βFor: ACCTGTCCTGTGTAATGAAAG
Rev: GCTTGTGCTCTGCTTGTG
IL-12 For: CAGAAGCTAACCATCTCCTGGTTTG
Rev: TCGGGAGTAATTTGGTGCTTCACAC
HPRT1 For: GTTGAAGATATAATTGACACTG
Rev: GGCATATCCAACAACAAAC