Table 1: Primer and TaqMan probe sequences for real-time PCR.

GeneForward primerReverse primerTaqman probe

GLUT45′ CCTGCCAGAAAGAGTCTGAAGC 3′5′ ATCCTTCAGCTCAGCCAGCA 3′5′ CAGAAACATCGGCCCAGCCTGTCA 3′
GS5′ GCTCAGAGCAAGGCTCGAAT 3′5′ CGGCCGGCGATAAAGAA 3′5′ TTATGGGCATCTGGACTTCAACTTGGACA 3′
HIF-1α5′ GCCCCAGATTCAGGATCAGA 3′5′ TGGGACTATTAGGCTCAGGTGAAC 3′5′ ACCTAGTCCTTCCGATGGAAGCACTAGACAA 3′
HO-15′ GCCAGCAACAAAGTGCAAGAT 3′5′ AGTGTAAGGACCCATCGGAGAA 3′5′ AGAGGGAAGCCCCCACTCAACACC 3′
Hsc705′ GCAGACACAGACCTTCACTACCTATT 3′5′ GGCACGCTCGCCTTCAT 3′5′ AACCTGAATAAGCACACCAGGCTGGTTG 3′
HSP725′ GCGTGATGACTGCCCTGAT 3′5′ CGCCCTCGTACACCTGGAT 3′5′ TCCCCACCAAGCAGACGCAGATCT 3′
IGF-IEa5′ CAGCGCCACACCGACAT 3′5′ TTGTTTCCTGCACTCCCTCTACT 3′5′ AAGACCCAGAAGGAAGTACATTTGAAGAACGC 3′
IL-65′ TCTCAGCCCTGAGAAAGGAGACA 3′5′ CATCTTTGGAAGGTTCAGGTTGT 3′5′ ACATGTGTGAAAGCAGCAAAGAGGCACTG 3′
LDH-A5′ ACAACAGGATTCTAGGTGGAGGTT 3′5′ GAGTTGATGTTTTTCCCAGTCCAT 3′5′ TGCATGTTGTCCTTTTTATCTGATCTGTGATTAAAGC 3′
LDH-B5′ GCTAAAGGATGATGAGGTTGCTC 3′5′ TCACTAGTCACAGGTCTTTTAGGTCC 3′5′ CTCAAGAAAAGTGCAGATACCCTGTGGGAC 3′
Myostatin5′ ACCAGGAGAAGATGGGCTGAA 3′5′ GTCAAGACCAAAATCCCTTCTGGA 3′5′ CCGTTTTTAGAGGTCAAGGTAACAGACACACCA 3′
PGC-1α5′ CAAGCCAAACCAACAACTTTATCTCT 3′5′ CACACTTAAGGTGCGTTCAATAGTC 3′5′ AGTCACCAAATGACCCCAAGGGTTCC 3′
TNFα5′ TCTGGCCCAGGCAGTCAGAT 3′5′ AGCTGCCCCTCAGCTTGA 3′5′ CAAGCCTGTAGCCCATGTTGTAGCAAACC 3′

GS: glycogen synthase; HIF-1α: hypoxia inducible factor-1; HO-1: heme oxygenase-1; HSP72 and HSc70: heat shock protein 70 and 72; IGF-1Ea: insulin-like growth factor-1Ea; IL-6: interleukin-6; LDH: lactate dehydrogenase; PGC-1α: peroxisome proliferator activated receptor gamma coactivator 1α; TNF-α: tumor necrosis factor alpha.