Table 1: Human primer sequences.

GeneSequence (5′-3′)Acc. no.PCR cyclesProduct size

GAPDH
ACCACAGTCCATGCCATCANM_00204622452
TCCACCACCCTGTTGCTGT

COL-1
CTGACCTTCCTGCGCCTGATGTCCXM_01265123300
GTCTGGGGCACCAACGTCCAAGGG

RUNX2
CGCATTCCTCATCCCAGTATNM_00101505130462
GACTGGCGGGGTGTAAGTAA

OPN
CCCACAGACCCTTCCAAGTAJ0476529279
ACACTATCACCTCGGCCATC

OCN
GTGCAGAGTCCAGCAAAGGTX5369829175
TCAGCCAACTCGTCACAGTC

SMAD1
CAACGCCACTTTTCCAGATTU5942330313
GCACCAGTGTTTTGGTTCCT

ALP: alkaline phosphatase; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; COL-I: collagen type I; RUNX2: runt-related transcription factor 2; OPN: osteopontin; OCN: osteocalcin; SMAD1: SMAD family member 1.