Research Article
miRNA Transcriptome of Hypertrophic Skeletal Muscle with Overexpressed Myostatin Propeptide
Table 3
Abundantly expressed novel miRNAs in control and transgenic libraries.
| Name | Mature sequence | Reads | Chromosome position | Strand | CN148 | CN150 | TN126 | TN135 | TN329 |
| NMmu-14 | ugauuggaagacacucugcaaca | 0 | 0 | 159 | 129 | 0 | 16 | ā | NMmu-36 | gauucggcugaucuggcuggc | 457 | 0 | 0 | 0 | 515 | 14 | ā |
|
|