Research Article
Modulation of Steroidogenic Pathway in Rat Granulosa Cells with Subclinical Cd Exposure and Insulin Resistance: An Impact on Female Fertility
Table 2
Details of genes, accession number, primers, annealing Tm, and expected size of the PCR-amplified c-DNA.
| Gene name | GenBank accession number | Sequence of the primer Fw primer Rv primer | Annealing temperature (°C) | Product size (bp) |
| StAR | NM_ 31558 | 5′ AGGCAGGGGGATCTTTCTAA 3′ 5′ TGCCTGACTAGGGTTTCGTT 3′ | 56.8 | 330 | 17β-HSD | AF035156 | 5′ CCTCCTTCGCCACTATCAGC 3′ 5′ GGAGACAAATGAGGGCTC 3′ | 55.4 | 653 | CYP19A1 | NM_017085 | 5′ GGAATCCATCAAGCAGCATT 3′ 5′ TTCCACCTCCGGATACTCTG 3′ | 58 | 493 | β-Actin | V01217 | 5′ CCTGCTTGCTGATCCACA 3′ 5′ CTGACCGAGCGTGGCTAC 3′ | 57 | 505 |
|
|