Research Article
Ras Oncogene-Mediated Progressive Silencing of Extracellular Superoxide Dismutase in Tumorigenesis
Table 1
PCR primer sequences used in the study.
| Human SOD3 forward | cttcgcctctgctgaagtct | Human SOD3 reverse | gggtgtttcggtacaaatgg | Rat sod3 forward | gacctggagatctggatgga | Rat sod3 reverse | gtggttggaggtgttctgct | Rabbit sod3 forward | gttgcgtgagcggaaaga | Rabbit sod3 reverse | gtgagcgcctgccagatctc | Human SOS1 forward | cacctcctcctcaaacacct | Human SOS1 reverse | gtgtgtgtgctcccttttgt | Human SOS2 forward | ttttgaagaacgggtggcag | Human SOS2 reverse | ttttcctttcctgcagtgcc | Human β-actin forward | tgcgtgacattaaggagaag | Human β-actin reverse | gctcgtagctcttctcca | Rat β-actin forward | tcgtgcgtgacattaaggag | Rat β-actin reverse | gtcaggcagctcgtagctct |
|
|
Primer designed against EF1alfa promoter.
|