Ras Oncogene-Mediated Progressive Silencing of Extracellular Superoxide Dismutase in Tumorigenesis

Table 1

PCR primer sequences used in the study.

Human SOD3 forward	cttcgcctctgctgaagtct
Human SOD3 reverse	gggtgtttcggtacaaatgg
Rat sod3 forward	gacctggagatctggatgga
Rat sod3 reverse	gtggttggaggtgttctgct
Rabbit sod3 forward	gttgcgtgagcggaaaga
Rabbit sod3 reverse	gtgagcgcctgccagatctc
Human SOS1 forward	cacctcctcctcaaacacct
Human SOS1 reverse	gtgtgtgtgctcccttttgt
Human SOS2 forward	ttttgaagaacgggtggcag
Human SOS2 reverse	ttttcctttcctgcagtgcc
Human β-actin forward	tgcgtgacattaaggagaag
Human β-actin reverse	gctcgtagctcttctcca
Rat β-actin forward	tcgtgcgtgacattaaggag
Rat β-actin reverse	gtcaggcagctcgtagctct

Primer designed against EF1alfa promoter.