Research Article
Next Generation Sequencing Identifies Five Major Classes of Potentially Therapeutic Enzymes Secreted by Lucilia sericata Medical Maggots
Table 9
Genes and qRT-PCR primers evaluated in this study.
| Clan | Family | MEROPS ID |
Peptidase sp. | Cluster | Primer sequences (5′- 3′) | (bp) | (%) | |
| AA | A1 | A01.092 |
CAD2 peptidase (M. domestica) | LST_LS005916 | 5′-GCTGCCAAGCTATTGCTGAT-3′ | 75 | 102 | 0.997 | 5′-CGGCTTGAATGTTTTCGTATT-3′ |
| CA | C1 | C01.A27 |
CG12163 protein (D. melanogaster) | LST_LS006048 | 5′- TTTCACCGGTAATCGCAAAT -3′ | 66 | 105 | 0.997 | 5′- GCAGCCTTTTGACGATGTTT -3′ |
| MA | M1 | M01.024 |
ERAP2 aminopeptidase | LST_LS004632 | 5′- CCATTCCGTCCGAT TCTT -3′ | 68 | 98 | 0.999 | 5′- ATCGGCATACTGGGCAAA -3′ |
| PB | T1 | T01.976 |
Proteasome subunit alpha 1 | LST_LS006843 | 5′- TCTTCACGCTCTCAAGACGA -3′ | 61 | 103 | 0.993 | 5′- GGTCTTGTGTTTCGCCATCT -3′ |
| PA | S1 | S01.993 |
Testis-specific protein 50 (H. sapiens) | LST_LS010066 | 5′- TATGGGCAGCCCTAACGA -3′ | 60 | 104 | 0.998 | 5′- AAAGAACGGAGAGCATCACCT -3′ |
|
|
Length of amplicon. Quantitative qRT-PCR efficiency. Coefficient of determination.
|