Research Article
No Association of CALCA Polymorphisms and Aseptic Loosening after Primary Total Hip Arthroplasty
Table 1
Localization of the analysed CALCA polymorphisms P1, P2, P3, and P4 in the CALCA genomic structure [
33].
| CALCA- | SNP rs cluster ID | Gen-locus | CALCA position | forward primer | reverse primer | product size |
| P1 | rs1553005 | g.1210 | 5′near gene | catttcaaagatgagtacactgcg | gcccaagaaatctgactcca | 186 bp |
| P2 | rs35815751 | g.2919 | intron 1 | Ccagaagtccactgtgctga | aagggggagaacttttggaa | 211 bp |
| P3 | rs5240 | g.4198 | exon 3 | Agcctgcactgagtttgctt | gggatccaccttccrgtgta | 239 bp |
| P4 | rs2956 | g.6609 | 3′near gene | Aaccctgagatcatcaacca | aaagggcaaatacagttcttga | 196 bp |
|
|