No Association of CALCA Polymorphisms and Aseptic Loosening after Primary Total Hip Arthroplasty

Table 1

Localization of the analysed CALCA polymorphisms P1, P2, P3, and P4 in the CALCA genomic structure [33].

CALCA-	SNP rs cluster ID	Gen-locus	CALCA position	forward primer	reverse primer	product size
P1	rs1553005	g.1210	5′near gene	catttcaaagatgagtacactgcg	gcccaagaaatctgactcca	186 bp
P2	rs35815751	g.2919	intron 1	Ccagaagtccactgtgctga	aagggggagaacttttggaa	211 bp
P3	rs5240	g.4198	exon 3	Agcctgcactgagtttgctt	gggatccaccttccrgtgta	239 bp
P4	rs2956	g.6609	3′near gene	Aaccctgagatcatcaacca	aaagggcaaatacagttcttga	196 bp