BioMed Research International: Molecular Biology The latest articles from Hindawi Publishing Corporation © 2015 , Hindawi Publishing Corporation . All rights reserved. Testosterone Depletion Induces Demethylation of Murine Reelin Promoter CpG Dinucleotides: A Preliminary Study Wed, 07 Oct 2015 09:27:13 +0000 Schizophrenia (SZ) is a debilitating mental disorder characterized by psychotic events, abnormal social behavior, false beliefs, and auditory hallucinations. Hypermethylation of the promoter region of reelin (RELN), a gene involved in regulation of neuronal positioning during telencephalic development, is strongly associated with low protein expression in several cortical structures and promoter hypermethylation in brain from postmortem SZ subjects. Recent experimental data suggests that testosterone is able to promote RELN demethylation, although no direct evidence of hormonal influence on reelin promoter methylation was obtained. We investigated if reduced levels of plasma testosterone in adult male mice lead to Reln promoter demethylation. Animals were administered with flutamide, an antiandrogenic compound, and reelin promoter methylation was assessed using methylationspecific PCR using bisulfite DNA from cerebellum. We found that flutamide was able to significantly lower plasma testosterone when compared to control mice, and treatment did not influence animal survival and body weight. We also show that low plasma testosterone was associated with demethylation of a cytosine residue located at −860 in reelin promoter region. These preliminary data suggest that androgenic hormones can influence cerebral reelin demethylation. To our knowledge, this is the first experimental approach directly linking testosterone depletion and RELN promoter methylation. Victor Augusto Moraes da Silva, Marília de Souza Dantas, Leonardo Agostinho de Castro Silva, Juliana Garcia Carneiro, and Bruno Luiz Fonseca Schamber-Reis Copyright © 2015 Victor Augusto Moraes da Silva et al. All rights reserved. Genetic Diversity of Mycobacterium tuberculosis Complex Isolated from Tuberculosis Patients in Bahir Dar City and Its Surroundings, Northwest Ethiopia Mon, 28 Sep 2015 13:52:39 +0000 The knowledge of the diversity of strains of Mycobacterium tuberculosis complex (MTBC) species in a specific geographical region can contribute to the control of tuberculosis (TB). This study was conducted to identify the MTBC isolates to the species and spoligotype international type (SIT) level by spoligotyping. A total of 168 MTBC isolates were recovered from TB patients, spoligotyped, and their patterns were compared with those of the strains registered in the SITVIT2 database. Of 168 isolates spoligotyped, 89 patterns were identified. Ninety-eight isolates were clustered into 19 strain groups with clustering percentage of 58.3%. Forty-four strains matched the preexisting SITs in the SITVIT2 database. The dominant strains were SIT289, SIT134, and SIT3411, comprising 16.7% (28/168), 7.14% (12/168), and 4.76% (8/168) of the isolates, respectively. Euro-American (51.2%), East-African-Indian (34.5%), and M. africanum (9.52%) were the major lineages identified. Two strains of M. bovis were isolated from TB lymphadenitis cases. The high percentage of clustered strains of M. tuberculosis could suggest that a small number of lineages of M. tuberculosis are causing the disease in the area while isolation of M. bovis could suggest its zoonotic potential. Additionally, identification of M. africanum requires further confirmation by tools with a better discriminatory power. Anwar Nuru, Gezahegne Mamo, Adane Worku, Aschalew Admasu, Girmay Medhin, Rembert Pieper, and Gobena Ameni Copyright © 2015 Anwar Nuru et al. All rights reserved. Efficient Mitochondrial Genome Editing by CRISPR/Cas9 Thu, 10 Sep 2015 05:48:07 +0000 The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system has been widely used for nuclear DNA editing to generate mutations or correct specific disease alleles. Despite its flexible application, it has not been determined if CRISPR/Cas9, originally identified as a bacterial defense system against virus, can be targeted to mitochondria for mtDNA editing. Here, we show that regular FLAG-Cas9 can localize to mitochondria to edit mitochondrial DNA with sgRNAs targeting specific loci of the mitochondrial genome. Expression of FLAG-Cas9 together with gRNA targeting Cox1 and Cox3 leads to cleavage of the specific mtDNA loci. In addition, we observed disruption of mitochondrial protein homeostasis following mtDNA truncation or cleavage by CRISPR/Cas9. To overcome nonspecific distribution of FLAG-Cas9, we also created a mitochondria-targeted Cas9 (mitoCas9). This new version of Cas9 localizes only to mitochondria; together with expression of gRNA targeting mtDNA, there is specific cleavage of mtDNA. MitoCas9-induced reduction of mtDNA and its transcription leads to mitochondrial membrane potential disruption and cell growth inhibition. This mitoCas9 could be applied to edit mtDNA together with gRNA expression vectors without affecting genomic DNA. In this brief study, we demonstrate that mtDNA editing is possible using CRISPR/Cas9. Moreover, our development of mitoCas9 with specific localization to the mitochondria should facilitate its application for mitochondrial genome editing. Areum Jo, Sangwoo Ham, Gum Hwa Lee, Yun-Il Lee, SangSeong Kim, Yun-Song Lee, Joo-Ho Shin, and Yunjong Lee Copyright © 2015 Areum Jo et al. All rights reserved. Identification of Type II Interferon Receptors in Geese: Gene Structure, Phylogenetic Analysis, and Expression Patterns Thu, 06 Aug 2015 13:23:52 +0000 Interferon γ receptor 1 (IFNGR1) and IFNGR2 are two cell membrane molecules belonging to class II cytokines, which play important roles in the IFN-mediated antiviral signaling pathway. Here, goose IFNGR1 and IFNGR2 were cloned and identified for the first time. Tissue distribution analysis revealed that relatively high levels of goose IFNγ mRNA transcripts were detected in immune tissues, including the harderian gland, cecal tonsil, cecum, and thymus. Relatively high expression levels of both IFNGR1 and IFNGR2 were detected in the cecal tonsil, which implicated an important role of IFNγ in the secondary immune system of geese. No specific correlation between IFNγ, IFNGR1, and IFNGR2 expression levels was observed in the same tissues of healthy geese. IFNγ and its cognate receptors showed different expression profiles, although they appeared to maintain a relatively balanced state. Furthermore, the agonist R848 led to the upregulation of goose IFNγ but did not affect the expression of goose IFNGR1 or IFNGR2. In summary, trends in expression of goose IFNγ and its cognate receptors showed tissue specificity, as well as an age-related dependency. These findings may help us to better understand the age-related susceptibility to pathogens in birds. Hao Zhou, Shun Chen, Yulin Qi, Qin Zhou, Mingshu Wang, Renyong Jia, Dekang Zhu, Mafeng Liu, Fei Liu, Xiaoyue Chen, and Anchun Cheng Copyright © 2015 Hao Zhou et al. All rights reserved. Mmu-miR-27a-5p-Dependent Upregulation of MCPIP1 Inhibits the Inflammatory Response in LPS-Induced RAW264.7 Macrophage Cells Thu, 30 Jul 2015 12:10:03 +0000 Lipopolysaccharide (LPS) stimulates macrophages to release proinflammatory cytokines. MicroRNAs (miRNAs) are short noncoding RNAs that are involved in inflammatory reaction. Our previously study identified the downregulated expression of mmu-miR-27a-5p in RAW267.4 cells treated with LPS. To dissect the mechanism that mmu-miR-27a-5p regulates target genes and affects proinflammatory cytokine secretion more clearly, based on previous bioinformatics prediction data, one of the potential target genes, MCPIP1 was observed to be upregulated with qRT-PCR and western blot. Luciferase reporter assays were performed to further confirm in silico prediction and determine that MCPIP1 is the target of mmu-miR-27-5p. The results suggested that mmu-miR-27a-5p directly targeted the 3′-UTR of MCPIP1 and the interaction between mmu-miR-27-5p and the 3′-UTR of MCPIP1 is sequence-specific. MCPIP1 overexpression decreased the secretion of IL-6, IL-1β, and IL-10 in macrophage cells stimulated with LPS. Our findings may provide the important information for the precise roles of mmu-miR-27a-5p in the macrophage inflammatory response to LPS stimulation in the future. Ying Cheng, Li Du, Hanwei Jiao, Huapei Zhu, Kailian Xu, Shiyu Guo, Qiaoyun Shi, Tianjing Zhao, Feng Pang, Xiaoxiao Jia, and Fengyang Wang Copyright © 2015 Ying Cheng et al. All rights reserved. Posttranscriptional Regulation and RNA Binding Proteins in Cancer Biology Mon, 27 Jul 2015 09:54:16 +0000 Claudia Ghigna, Luca Cartegni, Peter Jordan, and Maria Paola Paronetto Copyright © 2015 Claudia Ghigna et al. All rights reserved. An Association Rule Mining Approach to Discover lncRNAs Expression Patterns in Cancer Datasets Mon, 27 Jul 2015 07:26:45 +0000 In the past few years, the role of long noncoding RNAs (lncRNAs) in tumor development and progression has been disclosed although their mechanisms of action remain to be elucidated. An important contribution to the comprehension of lncRNAs biology in cancer could be obtained through the integrated analysis of multiple expression datasets. However, the growing availability of public datasets requires new data mining techniques to integrate and describe relationship among data. In this perspective, we explored the powerness of the Association Rule Mining (ARM) approach in gene expression data analysis. By the ARM method, we performed a meta-analysis of cancer-related microarray data which allowed us to identify and characterize a set of ten lncRNAs simultaneously altered in different brain tumor datasets. The expression profiles of the ten lncRNAs appeared to be sufficient to distinguish between cancer and normal tissues. A further characterization of this lncRNAs signature through a comodulation expression analysis suggested that biological processes specific of the nervous system could be compromised. Paolo Cremaschi, Roberta Carriero, Stefania Astrologo, Caterina Colì, Antonella Lisa, Silvia Parolo, and Silvia Bione Copyright © 2015 Paolo Cremaschi et al. All rights reserved. Posttranscriptional Regulation of Splicing Factor SRSF1 and Its Role in Cancer Cell Biology Sun, 26 Jul 2015 10:00:54 +0000 Over the past decade, alternative splicing has been progressively recognized as a major mechanism regulating gene expression patterns in different tissues and disease states through the generation of multiple mRNAs from the same gene transcript. This process requires the joining of selected exons or usage of different pairs of splice sites and is regulated by gene-specific combinations of RNA-binding proteins. One archetypical splicing regulator is SRSF1, for which we review the molecular mechanisms and posttranscriptional modifications involved in its life cycle. These include alternative splicing of SRSF1 itself, regulatory protein phosphorylation events, and the role of nuclear versus cytoplasmic SRSF1 localization. In addition, we resume current knowledge on deregulated SRSF1 expression in tumors and describe SRSF1-regulated alternative transcripts with functional consequences for cancer cell biology at different stages of tumor development. Vânia Gonçalves and Peter Jordan Copyright © 2015 Vânia Gonçalves and Peter Jordan. All rights reserved. Splicing Regulators and Their Roles in Cancer Biology and Therapy Sun, 26 Jul 2015 08:18:18 +0000 Alternative splicing allows cells to expand the encoding potential of their genomes. In this elegant mechanism, a single gene can yield protein isoforms with even antagonistic functions depending on the cellular physiological context. Alterations in splicing regulatory factors activity in cancer cells, however, can generate an abnormal protein expression pattern that promotes growth, survival, and other processes, which are relevant to tumor biology. In this review, we discuss dysregulated alternative splicing events and regulatory factors that impact pathways related to cancer. The SR proteins and their regulatory kinases SRPKs and CLKs have been frequently found altered in tumors and are examined in more detail. Finally, perspectives that support splicing machinery as target for the development of novel anticancer therapies are discussed. Maria Roméria da Silva, Gabriela Alves Moreira, Ronni Anderson Gonçalves da Silva, Éverton de Almeida Alves Barbosa, Raoni Pais Siqueira, Róbson Ricardo Teixera, Márcia Rogéria Almeida, Abelardo Silva Júnior, Juliana Lopes Rangel Fietto, and Gustavo Costa Bressan Copyright © 2015 Maria Roméria da Silva et al. All rights reserved. Splicing Regulation: A Molecular Device to Enhance Cancer Cell Adaptation Sun, 26 Jul 2015 08:07:28 +0000 Alternative splicing (AS) represents a major resource for eukaryotic cells to expand the coding potential of their genomes and to finely regulate gene expression in response to both intra- and extracellular cues. Cancer cells exploit the flexible nature of the mechanisms controlling AS in order to increase the functional diversity of their proteome. By altering the balance of splice isoforms encoded by human genes or by promoting the expression of aberrant oncogenic splice variants, cancer cells enhance their ability to adapt to the adverse growth conditions of the tumoral microenvironment. Herein, we will review the most relevant cancer-related splicing events and the underlying regulatory mechanisms allowing tumour cells to rapidly adapt to the harsh conditions they may face during the occurrence and development of cancer. Vittoria Pagliarini, Chiara Naro, and Claudio Sette Copyright © 2015 Vittoria Pagliarini et al. All rights reserved. Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage Sun, 26 Jul 2015 08:04:58 +0000 Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) that is located at the 5′-untranslated region (UTR) of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80) has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA) following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress. Marie-Jo Halaby, Yan Li, Benjamin R. Harris, Shuxia Jiang, W. Keith Miskimins, Margot P. Cleary, and Da-Qing Yang Copyright © 2015 Marie-Jo Halaby et al. All rights reserved. Emerging Roles of MicroRNAs in EGFR-Targeted Therapies for Lung Cancer Sun, 26 Jul 2015 07:58:10 +0000 Lung cancer is a leading cause of cancer mortality worldwide. Several molecular pathways underlying mechanisms of this disease have been partly elucidated, among which the epidermal growth factor receptor (EGFR) pathway is one of the well-known signaling cascades that plays a critical role in tumorigenesis. Dysregulation of the EGFR signaling is frequently found in lung cancer. The strategies to effectively inhibit EGFR signaling pathway have been mounted for developing anticancer therapeutic agents. However, most anti-EGFR-targeted agents fail to repress cancer progression because of developing drug-resistance. Therefore, studies of the mechanisms underpinning the resistance toward anti-EGFR agents may provide important findings for lung cancer treatment using anti-EGFR therapies. Recently, increasing numbers of miRNAs are correlated with the drug resistance of lung cancer cells to anti-EGFR agents, indicating that miRNAs may serve as novel targets and/or promising predictive biomarkers for anti-EGFR therapy. In this paper, we summarize the emerging role of miRNAs as regulators to modulate the EGFR signaling and the resistance of lung cancer cells to anti-EGFR therapy. We also highlight the evidence supporting the use of miRNAs as biomarkers for response to anti-EGFR agents and as novel therapeutic targets to circumvent the resistance of lung cancer cells to EGFR inhibitors. Fei Han, Jinxi He, Feng Li, Jiali Yang, Jun Wei, William C. Cho, and Xiaoming Liu Copyright © 2015 Fei Han et al. All rights reserved. Unravelling the RNA-Binding Properties of SAFB Proteins in Breast Cancer Cells Sun, 26 Jul 2015 07:50:19 +0000 Scaffold attachment factor B1 (SAFB1) and SAFB2 proteins are oestrogen (ER) corepressors that bind to and modulate ER activity through chromatin remodelling or interaction with the basal transcription machinery. SAFB proteins also have an internal RNA-recognition motif but little is known about the RNA-binding properties of SAFB1 or SAFB2. We utilised crosslinking and immunoprecipitation (iCLIP) coupled with high-throughput sequencing to enable a transcriptome-wide mapping of SAFB1 protein-RNA interactions in breast cancer MCF-7 cells. Analysis of crosslinking frequency mapped to transcript regions revealed that SAFB1 binds to coding and noncoding RNAs (ncRNAs). The highest proportion of SAFB1 crosslink sites mapped to ncRNAs, followed by intergenic regions, open reading frames (ORFs), introns, and 3′ or 5′ untranslated regions (UTR). Furthermore, we reveal that SAFB1 binds directly to RNA and its binding is particularly enriched at purine-rich sequences not dissimilar to the RNA-binding motifs for SR proteins. Using RNAi, we also show, for the first time, that single depletion of either SAFB1 or SAFB2 leads to an increase in expression of the other SAFB protein in both MCF-7 and MDA-MD231 breast cancer cells. Elaine Hong, Andrew Best, Hannah Gautrey, Jas Chin, Anshuli Razdan, Tomaz Curk, David J. Elliott, and Alison J. Tyson-Capper Copyright © 2015 Elaine Hong et al. All rights reserved. SAM68: Signal Transduction and RNA Metabolism in Human Cancer Sun, 26 Jul 2015 07:32:41 +0000 Alterations in expression and/or activity of splicing factors as well as mutations in cis-acting splicing regulatory sequences contribute to cancer phenotypes. Genome-wide studies have revealed more than 15,000 tumor-associated splice variants derived from genes involved in almost every aspect of cancer cell biology, including proliferation, differentiation, cell cycle control, metabolism, apoptosis, motility, invasion, and angiogenesis. In the past decades, several RNA binding proteins (RBPs) have been implicated in tumorigenesis. SAM68 (SRC associated in mitosis of 68 kDa) belongs to the STAR (signal transduction and activation of RNA metabolism) family of RBPs. SAM68 is involved in several steps of mRNA metabolism, from transcription to alternative splicing and then to nuclear export. Moreover, SAM68 participates in signaling pathways associated with cell response to stimuli, cell cycle transitions, and viral infections. Recent evidence has linked this RBP to the onset and progression of different tumors, highlighting misregulation of SAM68-regulated splicing events as a key step in neoplastic transformation and tumor progression. Here we review recent studies on the role of SAM68 in splicing regulation and we discuss its contribution to aberrant pre-mRNA processing in cancer. Paola Frisone, Davide Pradella, Anna Di Matteo, Elisa Belloni, Claudia Ghigna, and Maria Paola Paronetto Copyright © 2015 Paola Frisone et al. All rights reserved. Evaluation of Genetic Variations in Maize Seedlings Exposed to Electric Field Based on Protein and DNA Markers Wed, 17 Jun 2015 11:23:57 +0000 The current study analyzed proteins and nuclear DNA of electric fields (ELF) exposed and nonexposed maize seedlings for different exposure periods using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), isozymes, random amplified polymorphic DNA (RAPD), and comet assay, respectively. SDS-PAGE analysis revealed total of 46 polypeptides bands with different molecular weights ranging from 186.20 to 36.00 KDa. It generated distinctive polymorphism value of 84.62%. Leucine-aminopeptidase, peroxidase, and catalase isozymes showed the highest values of polymorphism (100%) based on zymograms number, relative front (), and optical intensity while esterase isozyme generated polymorphism value of 83.33%. Amino acids were analyzed using high-performance liquid chromatography, which revealed the presence of 17 amino acids of variable contents ranging from 22.65% to 28.09%. RAPD revealed that 78 amplified DNA products had highly polymorphism value (95.08%) based on band numbers, with variable sizes ranging from 120 to 992 base pairs and band intensity. Comet assay recorded the highest extent of nuclear DNA damage as percentage of tailed DNA (2.38%) and tail moment unit (5.36) at ELF exposure of maize nuclei for 5 days. The current study concluded that the longer ELF exposing periods had genotoxic stress on macromolecules of maize cells and biomarkers used should be augmented for reliable estimates of genotoxicity after exposure of economic plants to ELF stressors. Asma A. AL-Huqail and Ekram Abdelhaliem Copyright © 2015 Asma A. AL-Huqail and Ekram Abdelhaliem. All rights reserved. Molecular Phylogenetics 2014 Tue, 02 Jun 2015 07:12:34 +0000 Vassily Lyubetsky, William H. Piel, and Peter F. Stadler Copyright © 2015 Vassily Lyubetsky et al. All rights reserved. Comparative Analysis of Apicoplast-Targeted Protein Extension Lengths in Apicomplexan Parasites Sun, 31 May 2015 16:47:04 +0000 In general, the mechanism of protein translocation through the apicoplast membrane requires a specific extension of a functionally important region of the apicoplast-targeted proteins. The corresponding signal peptides were detected in many apicomplexans but not in the majority of apicoplast-targeted proteins in Toxoplasma gondii. In T. gondii signal peptides are either much diverged or their extension region is processed, which in either case makes the situation different from other studied apicomplexans. We propose a statistic method to compare extensions of the functionally important regions of apicoplast-targeted proteins. More specifically, we provide a comparison of extension lengths of orthologous apicoplast-targeted proteins in apicomplexan parasites. We focus on results obtained for the model species T. gondii, Neospora caninum, and Plasmodium falciparum. With our method, cross species comparisons demonstrate that, in average, apicoplast-targeted protein extensions in T. gondii are 1.5-fold longer than in N. caninum and 2-fold longer than in P. falciparum. Extensions in P. falciparum less than 87 residues in size are longer than the corresponding extensions in N. caninum and, reversely, are shorter if they exceed 88 residues. Alexandr V. Seliverstov, Oleg A. Zverkov, Svetlana N. Istomina, Sergey A. Pirogov, and Philip S. Kitsis Copyright © 2015 Alexandr V. Seliverstov et al. All rights reserved. Lengths of Orthologous Prokaryotic Proteins Are Affected by Evolutionary Factors Sun, 31 May 2015 12:55:48 +0000 Proteins of the same functional family (for example, kinases) may have significantly different lengths. It is an open question whether such variation in length is random or it appears as a response to some unknown evolutionary driving factors. The main purpose of this paper is to demonstrate existence of factors affecting prokaryotic gene lengths. We believe that the ranking of genomes according to lengths of their genes, followed by the calculation of coefficients of association between genome rank and genome property, is a reasonable approach in revealing such evolutionary driving factors. As we demonstrated earlier, our chosen approach, Bubble-sort, combines stability, accuracy, and computational efficiency as compared to other ranking methods. Application of Bubble Sort to the set of 1390 prokaryotic genomes confirmed that genes of Archaeal species are generally shorter than Bacterial ones. We observed that gene lengths are affected by various factors: within each domain, different phyla have preferences for short or long genes; thermophiles tend to have shorter genes than the soil-dwellers; halophiles tend to have longer genes. We also found that species with overrepresentation of cytosines and guanines in the third position of the codon (GC3 content) tend to have longer genes than species with low GC3 content. Tatiana Tatarinova, Bilal Salih, Jennifer Dien Bard, Irit Cohen, and Alexander Bolshoy Copyright © 2015 Tatiana Tatarinova et al. All rights reserved. miR-1322 Binding Sites in Paralogous and Orthologous Genes Sun, 31 May 2015 09:52:45 +0000 We searched for 2,563 microRNA (miRNA) binding sites in 17,494 mRNA sequences of human genes. miR-1322 has more than 2,000 binding sites in 1,058 genes with ratio of 85% and more. miR-1322 has 1,889 binding sites in CDSs, 215 binding sites in 5′ UTRs, and 160 binding sites in 3′ UTRs. From two to 28 binding sites have arranged localization with the start position through three nucleotides of each following binding site. The nucleotide sequences of these sites in CDSs encode oligopeptides with the same and/or different amino acid sequences. We found that 33% of the target genes encoded transcription factors. miR-1322 has arranged binding sites in the CDSs of orthologous MAMLD1, MAML2, and MAML3 genes. These sites encode a polyglutamine oligopeptide ranging from six to 47 amino acids in length. The properties of miR-1322 binding sites in orthologous and paralogous target genes are discussed. Raigul Niyazova, Olga Berillo, Shara Atambayeva, Anna Pyrkova, Aigul Alybayeva, and Anatoly Ivashchenko Copyright © 2015 Raigul Niyazova et al. All rights reserved. Phyloproteomic Analysis of 11780 Six-Residue-Long Motifs Occurrences Sun, 31 May 2015 09:43:41 +0000 How is it possible to find good traits for phylogenetic reconstructions? Here, we present a new phyloproteomic criterion that is an occurrence of simple motifs which can be imprints of evolution history. We studied the occurrences of 11780 six-residue-long motifs consisting of two randomly located amino acids in 97 eukaryotic and 25 bacterial proteomes. For all eukaryotic proteomes, with the exception of the Amoebozoa, Stramenopiles, and Diplomonadida kingdoms, the number of proteins containing the motifs from the first group (one of the two amino acids occurs once at the terminal position) made about 20%; in the case of motifs from the second (one of two amino acids occurs one time within the pattern) and third (the two amino acids occur randomly) groups, 30% and 50%, respectively. For bacterial proteomes, this relationship was 10%, 27%, and 63%, respectively. The matrices of correlation coefficients between numbers of proteins where a motif from the set of 11780 motifs appears at least once in 9 kingdoms and 5 phyla of bacteria were calculated. Among the correlation coefficients for eukaryotic proteomes, the correlation between the animal and fungi kingdoms (0.62) is higher than between fungi and plants (0.54). Our study provides support that animals and fungi are sibling kingdoms. Comparison of the frequencies of six-residue-long motifs in different proteomes allows obtaining phylogenetic relationships based on similarities between these frequencies: the Diplomonadida kingdoms are more close to Bacteria than to Eukaryota; Stramenopiles and Amoebozoa are more close to each other than to other kingdoms of Eukaryota. O. V. Galzitskaya and M. Yu. Lobanov Copyright © 2015 O. V. Galzitskaya and M. Yu. Lobanov. All rights reserved. A Database of Plastid Protein Families from Red Algae and Apicomplexa and Expression Regulation of the moeB Gene Sun, 31 May 2015 09:34:01 +0000 We report the database of plastid protein families from red algae, secondary and tertiary rhodophyte-derived plastids, and Apicomplexa constructed with the novel method to infer orthology. The families contain proteins with maximal sequence similarity and minimal paralogous content. The database contains 6509 protein entries, 513 families and 278 nonsingletons (from which 230 are paralog-free, and among the remaining 48, 46 contain at maximum two proteins per species, and 2 contain at maximum three proteins per species). The method is compared with other approaches. Expression regulation of the moeB gene is studied using this database and the model of RNA polymerase competition. An analogous database obtained for green algae and their symbiotic descendants, and applications based on it are published earlier. Oleg A. Zverkov, Alexandr V. Seliverstov, and Vassily A. Lyubetsky Copyright © 2015 Oleg A. Zverkov et al. All rights reserved. Advanced Glycation End Products Enhance Macrophages Polarization into M1 Phenotype through Activating RAGE/NF-κB Pathway Sun, 31 May 2015 08:12:08 +0000 Atherosclerotic lesions are accelerated in patients with diabetes. M1 (classically activated in contrast to M2 alternatively activated) macrophages play key roles in the progression of atherosclerosis. Since advanced glycation end products (AGEs) are major pathogenic factors and active inflammation inducers in diabetes mellitus, this study assessed the effects of AGEs on macrophage polarization. The present study showed that AGEs significantly promoted macrophages to express IL-6 and TNF-α. M1 macrophage markers such as iNOS and surface markers including CD11c and CD86 were significantly upregulated while M2 macrophage markers such as Arg1 and CD206 remained unchanged after AGEs stimulation. AGEs significantly increased RAGE expression in macrophages and activated NF-κB pathway, and the aforementioned effects were partly abolished by administration of anti-RAGE antibody or NF-κB inhibitor PDTC. In conclusion, our results suggest that AGEs enhance macrophage differentiation into proinflammatory M1 phenotype at least partly via RAGE/NF-κB pathway activation. Xian Jin, Tongqing Yao, Zhong’e Zhou, Jian Zhu, Song Zhang, Wei Hu, and Chengxing Shen Copyright © 2015 Xian Jin et al. All rights reserved. Molecular Biogeography of Tribe Thermopsideae (Leguminosae): A Madrean-Tethyan Disjunction Pattern with an African Origin of Core Genistoides Sun, 31 May 2015 07:23:32 +0000 Thermopsideae has 45 species and exhibits a series of interesting biogeographical distribution patterns, such as Madrean-Tethyan disjunction and East Asia-North America disjunction, with a center of endemism in the Qinghai-Xizang Plateau (QTP) and Central Asia. Phylogenetic analysis in this paper employed maximum likelihood using ITS, rps16, psbA-trnH, and trnL-F sequence data; biogeographical approaches included BEAST molecular dating and Bayesian dispersal and vicariance analysis (S-DIVA). The results indicate that the core genistoides most likely originated in Africa during the Eocene to Oligocene, ca. 55-30 Ma, and dispersed eastward to Central Asia at ca. 33.47 Ma. The origin of Thermopsideae is inferred as Central Asian and dated to ca. 28.81 Ma. Ammopiptanthus is revealed to be a relic. Birth of the ancestor of Thermopsideae coincided with shrinkage of the Paratethys Sea at ca. 30 Ma in the Oligocene. The Himalayan motion of QTP uplift of ca. 20 Ma most likely drove the diversification between Central Asia and North America. Divergences in East Asia, Central Asia, the Mediterranean, and so forth, within Eurasia, except for Ammopiptanthus, are shown to be dispersals from the QTP. The onset of adaptive radiation at the center of the tribe, with diversification of most species in Thermopsis and Piptanthus at ca. 4-0.85 Ma in Tibet and adjacent regions, seems to have resulted from intense northern QTP uplift during the latter Miocene to Pleistocene. Ming-Li Zhang, Jian-Feng Huang, Stewart C. Sanderson, Ping Yan, Yu-Hu Wu, and Bo-Rong Pan Copyright © 2015 Ming-Li Zhang et al. All rights reserved. Phylogeography of Pteronotropis signipinnis, P. euryzonus, and the P. hypselopterus Complex (Teleostei: Cypriniformes), with Comments on Diversity and History of the Gulf and Atlantic Coastal Streams Sun, 31 May 2015 07:15:55 +0000 The cyprinid genus Pteronotropis is endemic to southeastern Gulf of Mexico and Atlantic Ocean of North America. Never before has the genus been demonstrated to be monophyletic. We investigate both the phylogenetic relationships and the phylogeography of some species in the genus using mitochondrial ND2 sequences. In no analysis is the genus resolved as monophyletic if Notropis harperi is not included in the genus. Biogeographic and phylogeographic evaluations are conducted with Pteronotropis, including P. signipinnis, P. euryzonus, and the P. hypselopterus complex. Patterns of relationships and population genetic analyses support divergences within multiple clades both at the species level and within species that are tied to abiotic changes in the region. Replicated patterns across clades are observed, as well as patterns previously found in other taxa. Pteronotropis hypselopterus is likely not a natural grouping as populations from some drainages form clades more closely related to other species of the genus. The general patterns of relationships indicate likely cryptic species not currently recognized. Finally, the patterns of species relationships and clades and population structuring within species serve as another example of replicated divergences in the biodiversity east and west of the Mobile Bay. Richard L. Mayden and Jason Allen Copyright © 2015 Richard L. Mayden and Jason Allen. All rights reserved. Structural and Population Polymorphism of RT-Like Sequences in Avian Schistosomes Trichobilharzia szidati (Platyhelminthes: Digenea: Schistosomatidae) Sun, 31 May 2015 07:10:23 +0000 Recently we developed the genus-specific markers of the avian schistosomes of the genus Trichobilharzia, the causative agents of human cercarial dermatitis. The 7 novel genome sequences of T. franki, T. regenti, and T. szidati revealed similarity with genome repeat region of African schistosome Schistosoma mansoni. In the present work we analyzed the 37 new T. szidati sequences to study intragenome variability and host specificity for the parasite from three localities of East Europe. DNAs were isolated from cercariae or single sporocysts obtained from 6 lymnaeid snails Lymnaea stagnalis and L. palustris from Belarus and Russia. All sequences formed three diverged groups, one of which consists of the sequences with multiple deletions; other groups involved two paralogous copies with stop codons and frameshift mutations. Strong association between geographical distribution and snail host specificity cannot be established. All studied sequences have homology with the reverse transcriptase domain (RT) of Penelope-like elements (PLE) of S. mansoni and S. japonicum and new members of RT family were identified. We proposed that three diverged groups RT sequences of T. szidati are results of duplication or transposition of PLE during parasite evolution. Implications of the retroelement dynamics in the life history of avian schistosomes are discussed. S. K. Semyenova, G. G. Chrisanfova, A. S. Guliaev, A. P. Yesakova, and A. P. Ryskov Copyright © 2015 S. K. Semyenova et al. All rights reserved. The Variability of the Order Burkholderiales Representatives in the Healthcare Units Sun, 31 May 2015 06:57:45 +0000 Background and Aim. The order Burkholderiales became more abundant in the healthcare units since the late 1970s; it is especially dangerous for intensive care unit patients and patients with chronic lung diseases. The goal of this investigation was to reveal the real variability of the order Burkholderiales representatives and to estimate their phylogenetic relationships. Methods. 16S rDNA and genes of the Burkholderia cenocepacia complex (Bcc) Multi Locus Sequence Typing (MLST) scheme were used for the bacteria detection. Results. A huge diversity of genome size and organization was revealed in the order Burkholderiales that may prove the adaptability of this taxon’s representatives. The following variability of the Burkholderiales in Russian healthcare units has been revealed: Burkholderiaceae (Burkholderia, Pandoraea, and Lautropia), Alcaligenaceae (Achromobacter), and Comamonadaceae (Variovorax). The Burkholderia genus was the most diverse and was represented by 5 species and 16 sequence types (ST). ST709 and 728 were transmissible and often encountered in cystic fibrosis patients and in hospitals. A. xylosoxidans was estimated by 15 genotypes. The strains of first and second ones were the most numerous. Conclusions. Phylogenetic position of the genus Lautropia with smaller genome is ambiguous. The Bcc MLST scheme is applicable for all Burkholderiales representatives for resolving the epidemiological problems. Olga L. Voronina, Marina S. Kunda, Natalia N. Ryzhova, Ekaterina I. Aksenova, Andrey N. Semenov, Anna V. Lasareva, Elena L. Amelina, Alexandr G. Chuchalin, Vladimir G. Lunin, and Alexandr L. Gintsburg Copyright © 2015 Olga L. Voronina et al. All rights reserved. Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L. Sun, 31 May 2015 06:56:15 +0000 Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH) gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1). Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum. E. V. Karaushu, I. V. Lazebnaya, T. R. Kravzova, N. A. Vorobey, O. E. Lazebny, D. A. Kiriziy, O. P. Olkhovich, N. Yu. Taran, S. Ya. Kots, A. A. Popova, E. Omarova, and O. A. Koksharova Copyright © 2015 E. V. Karaushu et al. All rights reserved. Signs of Selection in Synonymous Sites of the Mitochondrial Cytochrome b Gene of Baikal Oilfish (Comephoridae) by mRNA Secondary Structure Alterations Sun, 31 May 2015 06:51:24 +0000 Studies over the past decade have shown a significant role of synonymous mutations in posttranscriptional regulation of gene expression, which is particularly associated with messenger RNA (mRNA) secondary structure alterations. Most studies focused on prokaryote genomes and the nuclear genomes of eukaryotes while little is known about the regulation of mitochondrial DNA (mtDNA) gene expression. This paper reveals signs of selection in synonymous sites of the mitochondrial cytochrome b gene (Cytb) of Baikal oilfish or golomyankas (Comephoridae) directed towards altering the secondary structure of the mRNA and probably altering the character of mtDNA gene expression. Our findings are based on comparisons of intraspecific genetic variation patterns of small golomyanka (Comephorus dybowski) and two genetic groups of big golomyanka (Comephorus dybowskii). Two approaches were used: (i) analysis of the distribution of synonymous mutations between weak-AT (W) and strong-GC (S) nucleotides within species and groups in accordance with mutation directions from central to peripheral haplotypes and (ii) approaches based on the predicted mRNA secondary structure. Veronika I. Teterina, Anatoliy M. Mamontov, Lyubov V. Sukhanova, and Sergei V. Kirilchik Copyright © 2015 Veronika I. Teterina et al. All rights reserved. Molecular Systematics of the Phoxinin Genus Pteronotropis (Otophysi: Cypriniformes) Sun, 31 May 2015 06:25:42 +0000 The genus Pteronotropis is widely distributed along the gulf slope of eastern North America from Louisiana to Florida and rivers in South Carolina along the Atlantic slope. Pteronotropis have very distinctive, flamboyant coloration. The habitats most frequently associated with these species include heavily vegetated backwater bayous to small sluggish or flowing tannin-stained streams. Although Pteronotropis is recognized as a valid genus, no phylogenetic analysis of all the species has corroborated its monophyly. In recent years, four additional species have been either described or elevated from synonymy: P. merlini, P. grandipinnis, P. stonei, and P. metallicus, with the wide-ranging P. hypselopterus complex. To examine relationships within this genus and test its monophyly, phylogenetic analyses were conducted using two nuclear genes, recombination activating gene 1, RAG1, and the first intron of S7 ribosomal protein gene in both maximum parsimony and Bayesian analyses. In no analysis was Pteronotropis, as currently recognized, recovered as monophyletic without the inclusion of the currently recognized Notropis harperi, herein referred to as Pteronotropis. Two major clades are supported: one inclusive of P. hubbsi, P. welaka, and P. harperi and the second inclusive of P. signipinnis, P. grandipinnis, P. hypselopterus plus P. merlini sister to P. euryzonus, and P. metallicus plus P. stonei. Richard L. Mayden and Jason S. Allen Copyright © 2015 Richard L. Mayden and Jason S. Allen. All rights reserved. Mcl-1 Is a Novel Target of miR-26b That Is Associated with the Apoptosis Induced by TRAIL in HCC Cells Thu, 21 May 2015 08:50:14 +0000 Aim. To investigate the role of miR-26b and Mcl-1 in TRAIL-inducing cell death in hepatocellular carcinoma. Methods. The expression of miR-26b and Mcl-1 in HCC was detected by RT-qPCR and western blot. The regulation of Mcl-1 by miR-26b was determined by luciferase reporter assay. MTT and flow cytometry were employed to detect the cell viability and apoptosis. Results. miR-26b is commonly downregulated in HCC cell lines compared with the LO2 cell line. In contrast, the Mcl-1 expression is upregulated in HCC cell lines. Bioinformatic analysis identified a putative target site in the Mcl-1 mRNA for miR-26b and luciferase reporter assay showed that miR-26b directly targeted the 3′-UTR (3′-Untranslated Regions) of Mcl-1 mRNA. Transfection of miR-26b mimics suppressed Mcl-1 expression in HCC cells and sensitized the cancer cells to TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) cytotoxicity. In addition, transfection of HCC cells with Mcl-1 expression plasmid abolished the sensitization effect of miR-26b to TRAIL-inducing apoptosis. Conclusions. Our study showed that miR-26b was a negative regulator of Mcl-1 gene and sensitized TRAIL-inducing apoptosis in HCC cells, suggesting that the miR-26b-Mcl-1 pathway might be a novel target for the treatment of HCC. Chunlin Jiang, Jianting Long, Baoxian Liu, Xiaoyan Xie, and Ming Kuang Copyright © 2015 Chunlin Jiang et al. All rights reserved. Identification, Characterization, and Developmental Expression Pattern of Type III Interferon Receptor Gene in the Chinese Goose Sun, 10 May 2015 10:59:38 +0000 Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-λ) was a newly identified member of IFN family, which plays IFN-like antiviral activity. Towards a better understanding of the type III interferon system in birds, type III interferon lambda receptor (IFNLR1) was first identified in the Chinese goose. In this paper, we had cloned 1952 bp for goose IFNLR1 (goIFNLR1), including an ORF of 1539 bp, encoding a 512-amino acid protein with a 20 aa predict signal peptide at its N terminal and a 23 aa transmembrane region. The predicted amino acid sequence of goIFNLR1 has 90%, 73%, and 34% identity with duck IFNLR1 (predicted sequence), chicken IFNLR1, and human IFNLR1, respectively. And the age-related tissue distribution of goIFNLR1 was identified by Real Time quantitative PCR (RT-qPCR), we found that the goIFNLR1 has a mainly expression in epithelium-rich tissues similar to other species’, such as small intestinal, lung, liver, and stomach. Moreover, a relatively high expression of goIFNLR1 was also observed in the secondary immune tissues (harderian gland and cecal tonsil). The identification and tissue distribution of goIFNLR1 will facilitate further study of the role of IFN-λ in goose antiviral defense. Qin Zhou, Shun Chen, Yulin Qi, Hao Zhou, Mingshu Wang, Renyong Jia, Dekang Zhu, Mafeng Liu, Fei Liu, Xiaoyue Chen, Xue Zhou, and Anchun Cheng Copyright © 2015 Qin Zhou et al. All rights reserved. miRNA Profiles of Tubular Cells: Diagnosis of Kidney Injury Thu, 30 Apr 2015 08:34:50 +0000 MicroRNAs (miRNAs) are small noncoding RNAs of 18–23 nucleotides that regulate gene expression. Recently, plasma miRNAs have been investigated as biomarkers for various physiological and pathological conditions. The present study details the conserved miRNA expression profiles of tubular tissues, and discusses whether they could be used to distinguish between proximal tubule injury, diagnose acute kidney injury (AKI), and the early-stage renal tubular dysfunction. miRNA expression was assessed with miRNA array and real-time reverse transcription polymerase chain reaction using the TaqMan system. The expression profiles of miR-200a/b/c, miR-145, miR-192, miR-194, miR-216a/b, miR-217, and miR-449a in human and rat tubular tissues such as the kidneys, lung, small intestine, and various exocrine glands were adequate for discriminating tubular tissues. In the kidney, miR-192 and miR-194 were highly expressed, whereas miR-145 and miR-449a were absent. miR-145 and miR-449a were relatively specifically expressed in small intestine and lung, respectively. Therefore, the combined levels of miR-200a/b/c, miR-192, and miR-194 in plasma were very useful in diagnosing AKI induced by contact freezing in mice. Moreover, urinary miR-200a levels were useful for the diagnosis of renal tubular dysfunction in Dahl salt-sensitive rat with high salt administration. Our results indicate that miRNA expression profiles are useful as biomarkers for identification of various kidney injuries. Naoko Kito, Kosuke Endo, Masahiro Ikesue, Huachun Weng, and Naoharu Iwai Copyright © 2015 Naoko Kito et al. All rights reserved. DNA Methylation and Histone Modifications Are the Molecular Lock in Lentivirally Transduced Hematopoietic Progenitor Cells Sun, 19 Apr 2015 09:48:13 +0000 Stable introduction of a functional gene in hematopoietic progenitor cells (HPCs) has appeared to be an alternative approach to correct genetically linked blood diseases. However, it is still unclear whether lentiviral vector (LV) is subjected to gene silencing in HPCs. Here, we show that LV carrying green fluorescent protein (GFP) reporter gene driven by cytomegalovirus (CMV) promoter was subjected to transgene silencing after transduction into HPCs. This phenomenon was not due to the deletion of proviral copy number. Study using DNA demethylating agent and histone deacetylase (HDAC) inhibitor showed that the drugs could either prevent or reverse the silencing effect. Using sodium bisulfite sequencing and chromatin immunoprecipitation (ChIP) assay, we demonstrated that DNA methylation occurred soon after LV transduction. At the highest level of gene expression, CMV promoter was acetylated and was in a euchromatin state, while GFP reporter gene was acetylated but was strangely in a heterochromatin state. When the expression declined, CMV promoter underwent transition from acetylated and euchromatic state to a heterochromatic state, while the GFP reporter gene was in deacetylated and heterochromatic state. With these, we verify that DNA methylation and dynamic histone modifications lead to transgene silencing in HPCs transduced with LV. Siew Ching Ngai, Rozita Rosli, Akram Al Abbar, and Syahril Abdullah Copyright © 2015 Siew Ching Ngai et al. All rights reserved. IFN-CSP Inhibiting Hepatitis B Virus in HepG2.2.15 Cells Involves JAK-STAT Signal Pathway Mon, 16 Mar 2015 09:00:58 +0000 Frequent and high-dose administration of interferon to patients with viral hepatitis results in various side effects. In our previous study, a novel liver-targeting interferon (IFN-CSP) combining Plasmodium region I peptide with IFNα2b was successfully designed and expressed in the Escherichia coli expression systems. This targeting would target the IFNα2b specifically to the liver, thus reducing the adverse events. In the present study, we further investigated the anti-HBV effects and molecular mechanisms of recombinant IFN-CSP in HepG2.2.15 cell line. Hepatitis B surface antigen (HBsAg) and HBe antigen (HBeAg) in the culture supernatants were analyzed by enzyme-linked immunosorbent assay (ELISA). HBV-DNA was measured by real-time quantitative PCR. HBV core protein was assayed by immunofluorescent and western blot analysis. The expressions of signal transducers and transactivator 1 (STAT1), STAT2, IFN regulatory factor 9 (IRF-9), and 2′-5′-oligoadenylate synthetase 1 (OAS1) were investigated by the reverse transcription PCR and western blot analysis. Results indicate IFN-CSP efficiently inhibited HBsAg and HBeAg secretion, HBV-DNA replication, and HBV core protein expression in HepG2.2.15 cells. The anti-HBV mechanisms involve activation of JAK-STAT signaling and increase of the anti-HBV protein OAS expression. IFN-CSP could be a good substitute for IFNα2b for anti-HBV treatment. Xuemei Lu, Jie Wang, Xiaobao Jin, Yanting Huang, Wenting Zeng, and Jiayong Zhu Copyright © 2015 Xuemei Lu et al. All rights reserved. MicroRNA and mRNA Features of Malignant Pleural Mesothelioma and Benign Asbestos-Related Pleural Effusion Sun, 01 Feb 2015 13:13:18 +0000 Introduction. We investigated the expression of microRNAs and mRNAs in pleural tissues from patients with either malignant pleural mesothelioma or benign asbestos-related pleural effusion. Methods. Fresh frozen tissues from a total of 18 malignant pleural mesothelioma and 6 benign asbestos-related pleural effusion patients were studied. Expression profiling of mRNA and microRNA was performed using standard protocols. Results. We discovered significant upregulation of multiple microRNAs in malignant pleural mesothelioma compared to benign asbestos-related pleural effusion. Hsa-miR-484, hsa-miR-320, hsa-let-7a, and hsa-miR-125a-5p were able to discriminate malignant from benign disease. Dynamically regulated mRNAs were also identified. MET was the most highly overexpressed gene in malignant pleural mesothelioma compared to benign asbestos-related pleural effusion. Integrated analyses examining microRNA-mRNA interactions suggested multiple altered targets within the Notch signaling pathway. Conclusions. Specific microRNAs and mRNAs may have diagnostic utility in differentiating patients with malignant pleural mesothelioma from benign asbestos-related pleural effusion. These studies may be particularly helpful in patients who reside in a region with a high incidence of mesothelioma. Guntulu Ak, Sandra C. Tomaszek, Farhad Kosari, Muzaffer Metintas, James R. Jett, Selma Metintas, Huseyin Yildirim, Emine Dundar, Jie Dong, Marie Christine Aubry, Dennis A. Wigle, and Charles F. Thomas Jr. Copyright © 2015 Guntulu Ak et al. All rights reserved. MicroRNAs and Cardiovascular Diseases Sun, 01 Feb 2015 12:32:02 +0000 Coronary artery diseases (CAD) and heart failure have high mortality rate in the world, although much progress has been made in this field in last two decades. There is still a clinical need for a novel diagnostic approach and a therapeutic strategy to decrease the incidence of CAD. MicroRNAs (miRNAs) are highly conserved noncoding small RNA molecules that regulate a large fraction of the genome by binding to complementary messenger RNA sequences, resulting in posttranscriptional gene silencing. Recent studies have shown that specific miRNAs are involved in whole stage of atherosclerosis, from endothelium dysfunction to plaque rupture. These findings suggest that miRNAs are potential biomarkers in early diagnosis and therapeutic targets in CAD. In the present review, we highlight the role of miRNAs in every stage of atherosclerosis, and discuss the prospects of miRNAs in the near future. Tsuyoshi Nishiguchi, Toshio Imanishi, and Takashi Akasaka Copyright © 2015 Tsuyoshi Nishiguchi et al. All rights reserved. Diagnosis of Neisseria gonorrhoeae Using Molecular Beacon Sat, 31 Jan 2015 12:30:25 +0000 Neisseria gonorrhoeae is an important sexually transmitted diseases (STD) causing pathogen worldwide. Due to absence of an affordable diagnostic assay, routine screening of gonococcal infection becomes impossible in developing countries where infection rates are maximum. Treatment is given on the basis of symptoms alone which leads to spread of infection. Thus, development of a rapid, sensitive, specific, and PCR based visual diagnostic assay suitable for developing countries, required for better disease management, is aimed at in present study. Endocervical swabs were collected from patients visiting gynecology department of various hospitals in Delhi. In-house PCR based assay was developed and modified to visual assay using molecular beacon for end-point detection. It was evaluated against Roche AMPLICOR NG kit and rmp gene. Specificity of beacon was confirmed by competition experiments. Diagnostic test was 98.21% specific and 99.59% sensitive whereas negative and positive predicted value were 99.40% and 98.78%, respectively. We also observed that twice the concentration (2X) of premix was stable at 4°C for 4 months and dry swab samples gave concordant results with that of wet swabs. These features make the test best suitable for routine diagnosis of genital infections in developing countries. Divya Sachdev, Achchhe Lal Patel, Subash Chandra Sonkar, Indu Kumari, and Daman Saluja Copyright © 2015 Divya Sachdev et al. All rights reserved. Correlation between Serum Levels of High Mobility Group Box-1 Protein and Pancreatitis: A Meta-Analysis Wed, 28 Jan 2015 08:05:39 +0000 Background. Aberrant expression of high mobility group box-1 protein (HMGB1) contributes to the progression of various inflammatory diseases. This meta-analysis focused on the clinical significance of serum HMGB1 levels in pancreatitis patients, with the goal of building a novel diagnostic score model. Method. We conducted a meta-analysis by searching in the PubMed, Embase, Web of Science, Cochrane Library, CISCOM, CINAHL, Google Scholar, China BioMedicine (CBM), and China National Knowledge Infrastructure (CNKI) databases without any language restrictions. Studies were pooled and standard mean difference (SMD) and its corresponding 95% confidence intervals (95% CIs) were calculated. Version 12.0 STATA software was used for statistical analysis. Results. We performed a final analysis of 841 subjects from 12 clinical case-control studies. The meta-analysis results showed a positive association between serum HMGB1 levels and the progression of pancreatitis. In the subgroup analysis by country, high serum level of HMGB1 may be related to pancreatitis progression in China, Korea, Hungary, and Japan populations (all ). Conclusion. The present meta-analysis indicated that serum HMGB1 level was statistically elevated in patients with pancreatitis, and thus serum levels of HMGB1 could be determined to be a useful biomarker for pancreatitis patients. Yan Lin, Lian-Jie Lin, Yu Jin, Yong Cao, Ying Zhang, Chang-Qing Zheng, Jia-Li Liu, and Sheng-Li Yang Copyright © 2015 Yan Lin et al. All rights reserved. Recent Novel High-Tech Researches in Molecular Biology Wed, 28 Jan 2015 07:01:17 +0000 Calvin Yu-Chian Chen, Kuo-Chen Chou, James David Adams, Tai-Ping Fan, and Gerhard Litscher Copyright © 2015 Calvin Yu-Chian Chen et al. All rights reserved. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference Thu, 22 Jan 2015 14:21:12 +0000 As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV) and/or Sorghum mosaic virus (SrMV), with additional differences in viral strains. RNA interference (RNAi) is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP) genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms. Jinlong Guo, Shiwu Gao, Qinliang Lin, Hengbo Wang, Youxiong Que, and Liping Xu Copyright © 2015 Jinlong Guo et al. All rights reserved. Positive Association of Vitamin D Receptor Gene Variations with Multiple Sclerosis in South East Iranian Population Tue, 20 Jan 2015 12:42:30 +0000 Among the factors postulated to play a role in MS susceptibility, the role of vitamin D is outstanding. Since the function of vitamin D receptor (VDR) represents the effect of vitamin D on the body and genetic variations in VDR gene may affect its function, we aim to highlight the association of two VDR gene polymorphisms with MS susceptibility. In current study, we recruited 113 MS patients and 122 healthy controls. TaqI (rs731236) and ApaI (rs7975232) genetic variations in these two groups were evaluated using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. All genotype and allele frequencies in both variations showed association with the disease status. However, to find the definite connection between genetic variations in VDR gene and MS disease in a population of South East of Iran, more researches on gene structure and its function with regard to patients’ conditions are required. Mehrnaz Narooie-Nejad, Maryam Moossavi, Adam Torkamanzehi, and Ali Moghtaderi Copyright © 2015 Mehrnaz Narooie-Nejad et al. All rights reserved. Next-Generation Technologies for Multiomics Approaches Including Interactome Sequencing Mon, 12 Jan 2015 06:23:55 +0000 The development of high-speed analytical techniques such as next-generation sequencing and microarrays allows high-throughput analysis of biological information at a low cost. These techniques contribute to medical and bioscience advancements and provide new avenues for scientific research. Here, we outline a variety of new innovative techniques and discuss their use in omics research (e.g., genomics, transcriptomics, metabolomics, proteomics, and interactomics). We also discuss the possible applications of these methods, including an interactome sequencing technology that we developed, in future medical and life science research. Hiroyuki Ohashi, Mai Hasegawa, Kentaro Wakimoto, and Etsuko Miyamoto-Sato Copyright © 2015 Hiroyuki Ohashi et al. All rights reserved. Potential Inhibitors for Isocitrate Lyase of Mycobacterium tuberculosis and Non-M. tuberculosis: A Summary Thu, 08 Jan 2015 09:08:04 +0000 Isocitrate lyase (ICL) is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle), especially Mycobacterium tuberculosis (MTB). In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a) MTB ICL with natural compounds; (b) MTB ICL with synthetic compounds; (c) non-MTB ICL with natural compounds; and (d) non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL. Yie-Vern Lee, Habibah A. Wahab, and Yee Siew Choong Copyright © 2015 Yie-Vern Lee et al. All rights reserved. Targeted Next Generation Sequencing Identifies Novel Mutations in RP1 as a Relatively Common Cause of Autosomal Recessive Rod-Cone Dystrophy Tue, 06 Jan 2015 12:59:36 +0000 We report ophthalmic and genetic findings in families with autosomal recessive rod-cone dystrophy (arRCD) and RP1 mutations. Detailed ophthalmic examination was performed in 242 sporadic and arRCD subjects. Genomic DNA was investigated using our customized next generation sequencing panel targeting up to 123 genes implicated in inherited retinal disorders. Stringent filtering coupled with Sanger sequencing and followed by cosegregation analysis was performed to confirm biallelism and the implication of the most likely disease causing variants. Sequencing identified 9 RP1 mutations in 7 index cases. Eight of the mutations were novel, and all cosegregated with severe arRCD phenotype, found associated with additional macular changes. Among the identified mutations, 4 belong to a region, previously associated with arRCD, and 5 others in a region previously associated with adRCD. Our prevalence studies showed that RP1 mutations account for up to 2.5% of arRCD. These results point out for the necessity of sequencing RP1 when genetically investigating sporadic and arRCD. It further highlights the interest of unbiased sequencing technique, which allows investigating the implication of the same gene in different modes of inheritance. Finally, it reports that different regions of RP1 can also lead to arRCD. Said El Shamieh, Elise Boulanger-Scemama, Marie-Elise Lancelot, Aline Antonio, Vanessa Démontant, Christel Condroyer, Mélanie Letexier, Jean-Paul Saraiva, Saddek Mohand-Saïd, José-Alain Sahel, Isabelle Audo, and Christina Zeitz Copyright © 2015 Said El Shamieh et al. All rights reserved. Plants Coping Abiotic and Biotic Stresses: A Tale of Diligent Management Mon, 05 Jan 2015 09:51:47 +0000 Hatem Rouached, Sikander Pal, Shimon Rachmilevitch, Marc Libault, and Lam-Son Phan Tran Copyright © 2015 Hatem Rouached et al. All rights reserved. DT2008: A Promising New Genetic Resource for Improved Drought Tolerance in Soybean When Solely Dependent on Symbiotic N2 Fixation Mon, 05 Jan 2015 06:16:23 +0000 Water deficit is one of the major constraints for soybean production in Vietnam. The soybean breeding research efforts conducted at the Agriculture Genetics Institute (AGI) of Vietnam resulted in the development of promising soybean genotypes, suitable for the drought-stressed areas in Vietnam and other countries. Such a variety, namely, DT2008, was recommended by AGI and widely used throughout the country. The aim of this work was to assess the growth of shoots, roots, and nodules of DT2008 versus Williams 82 (W82) in response to drought and subsequent rehydration in symbiotic association as a means to provide genetic resources for genomic research. Better shoot, root, and nodule growth and development were observed in the cultivar DT2008 under sufficient, water deficit, and recovery conditions. Our results represent a good foundation for further comparison of DT2008 and W82 at molecular levels using high throughput omic technologies, which will provide huge amounts of data, enabling us to understand the genetic network involved in regulation of soybean responses to water deficit and increasing the chances of developing drought-tolerant cultivars. Saad Sulieman, Chien Van Ha, Maryam Nasr Esfahani, Yasuko Watanabe, Rie Nishiyama, Chung Thi Bao Pham, Dong Van Nguyen, and Lam-Son Phan Tran Copyright © 2015 Saad Sulieman et al. All rights reserved. Interaction Analysis through Proteomic Phage Display Thu, 11 Sep 2014 09:10:37 +0000 Phage display is a powerful technique for profiling specificities of peptide binding domains. The method is suited for the identification of high-affinity ligands with inhibitor potential when using highly diverse combinatorial peptide phage libraries. Such experiments further provide consensus motifs for genome-wide scanning of ligands of potential biological relevance. A complementary but considerably less explored approach is to display expression products of genomic DNA, cDNA, open reading frames (ORFs), or oligonucleotide libraries designed to encode defined regions of a target proteome on phage particles. One of the main applications of such proteomic libraries has been the elucidation of antibody epitopes. This review is focused on the use of proteomic phage display to uncover protein-protein interactions of potential relevance for cellular function. The method is particularly suited for the discovery of interactions between peptide binding domains and their targets. We discuss the largely unexplored potential of this method in the discovery of domain-motif interactions of potential biological relevance. Gustav N. Sundell and Ylva Ivarsson Copyright © 2014 Gustav N. Sundell and Ylva Ivarsson. All rights reserved. Applications of Flow Cytometry to Characterize Bacterial Physiological Responses Tue, 09 Sep 2014 13:09:09 +0000 Although reports of flow cytometry (FCM) applied to bacterial analysis are increasing, studies of FCM related to human cells still vastly outnumber other reports. However, current advances in FCM combined with a new generation of cellular reporter probes have made this technique suitable for analyzing physiological responses in bacteria. We review how FCM has been applied to characterize distinct physiological conditions in bacteria including responses to antibiotics and other cytotoxic chemicals and physical factors, pathogen-host interactions, cell differentiation during biofilm formation, and the mechanisms governing development pathways such as sporulation. Since FCM is suitable for performing studies at the single-cell level, we describe how this powerful technique has yielded invaluable information about the heterogeneous distribution of differently and even specialized responding cells and how it may help to provide insights about how cell interaction takes place in complex structures, such as those that prevail in bacterial biofilms. Verónica Ambriz-Aviña, Jorge A. Contreras-Garduño, and Mario Pedraza-Reyes Copyright © 2014 Verónica Ambriz-Aviña et al. All rights reserved. Female Aging Alters Expression of Human Cumulus Cells Genes that Are Essential for Oocyte Quality Wed, 03 Sep 2014 08:41:20 +0000 Impact of female aging is an important issue in human reproduction. There was a need for an extensive analysis of age impact on transcriptome profile of cumulus cells (CCs) to link oocyte quality and developmental potential with patient’s age. CCs from patients of three age groups were analyzed individually using microarrays. RT-qPCR validation was performed on independent CC cohorts. We focused here on pathways affected by aging in CCs that may explain the decline of oocyte quality with age. In CCs collected from patients >37 years, angiogenic genes including ANGPTL4, LEPR, TGFBR3, and FGF2 were significantly overexpressed compared to patients of the two younger groups. In contrast genes implicated in TGF-β signaling pathway such as AMH, TGFB1, inhibin, and activin receptor were underexpressed. CCs from patients whose ages are between 31 and 36 years showed an overexpression of genes related to insulin signaling pathway such as IGFBP3, PIK3R1, and IGFBP5. A bioinformatic analysis was performed to identify the microRNAs that are potential regulators of the differentially expressed genes of the study. It revealed that the pathways impacted by age were potential targets of specific miRNAs previously identified in our CCs small RNAs sequencing. Tamadir Al-Edani, Said Assou, Alice Ferrières, Sophie Bringer Deutsch, Anna Gala, Charles-Henri Lecellier, Ounissa Aït-Ahmed, and Samir Hamamah Copyright © 2014 Tamadir Al-Edani et al. All rights reserved. The Characteristics of Ubiquitous and Unique Leptospira Strains from the Collection of Russian Centre for Leptospirosis Tue, 02 Sep 2014 12:40:51 +0000 Background and Aim. Leptospira, the causal agent of leptospirosis, has been isolated from the environment, patients, and wide spectrum of animals in Russia. However, the genetic diversity of Leptospira in natural and anthropurgic foci was not clearly defined. Methods. The recent MLST scheme was used for the analysis of seven pathogenic species. 454 pyrosequencing technology was the base of the whole genome sequencing (WGS). Results. The most wide spread and prevalent Leptospira species in Russia were L. interrogans, L. kirschneri, and L. borgpetersenii. Five STs, common for Russian strains: 37, 17, 199, 110, and 146, were identified as having a longtime and ubiquitous distribution in various geographic areas. Unexpected properties were revealed for the environmental Leptospira strain Bairam-Ali. WGS of this strain genome suggested that it combined the features of the pathogenic and nonpathogenic strains and may be a reservoir of the natural resistance genes. Results of the comparative analysis of rrs and rpoB genes and MLST loci for different Leptospira species strains and phenotypic and serological properties of the strain Bairam-Ali suggested that it represented separate Leptospira species. Conclusions. Thus, the natural and anthropurgic foci supported ubiquitous Leptospira species and the pool of genes important for bacterial adaptivity to various conditions. Olga L. Voronina, Marina S. Kunda, Ekaterina I. Aksenova, Natalia N. Ryzhova, Andrey N. Semenov, Evgeny M. Petrov, Lubov V. Didenko, Vladimir G. Lunin, Yuliya V. Ananyina, and Alexandr L. Gintsburg Copyright © 2014 Olga L. Voronina et al. All rights reserved. Curcumin, a Natural Antioxidant, Acts as a Noncompetitive Inhibitor of Human RNase L in Presence of Its Cofactor 2-5A In Vitro Tue, 02 Sep 2014 00:00:00 +0000 Ribonuclease L (RNase L) is an antiviral endoribonuclease of the innate immune system, which is induced and activated by viral infections, interferons, and double stranded RNA (dsRNA) in mammalian cells. Although, RNase L is generally protective against viral infections, abnormal RNase L expression and activity have been associated with a number of diseases. Here, we show that curcumin, a natural plant-derived anti-inflammatory active principle, inhibits RNase L activity; hence, it may be exploited for therapeutic interventions in case of pathological situations associated with excess activation of RNase L. Ankush Gupta and Pramod C. Rath Copyright © 2014 Ankush Gupta and Pramod C. Rath. All rights reserved. Multifunctional Role of ATM/Tel1 Kinase in Genome Stability: From the DNA Damage Response to Telomere Maintenance Thu, 28 Aug 2014 15:27:02 +0000 The mammalian protein kinase ataxia telangiectasia mutated (ATM) is a key regulator of the DNA double-strand-break response and belongs to the evolutionary conserved phosphatidylinositol-3-kinase-related protein kinases. ATM deficiency causes ataxia telangiectasia (AT), a genetic disorder that is characterized by premature aging, cerebellar neuropathy, immunodeficiency, and predisposition to cancer. AT cells show defects in the DNA damage-response pathway, cell-cycle control, and telomere maintenance and length regulation. Likewise, in Saccharomyces cerevisiae, haploid strains defective in the TEL1 gene, the ATM ortholog, show chromosomal aberrations and short telomeres. In this review, we outline the complex role of ATM/Tel1 in maintaining genomic stability through its control of numerous aspects of cellular survival. In particular, we describe how ATM/Tel1 participates in the signal transduction pathways elicited by DNA damage and in telomere homeostasis and its importance as a barrier to cancer development. Enea Gino Di Domenico, Elena Romano, Paola Del Porto, and Fiorentina Ascenzioni Copyright © 2014 Enea Gino Di Domenico et al. All rights reserved. Molecular Characterization and Screening for Sheath Blight Resistance Using Malaysian Isolates of Rhizoctonia solani Thu, 28 Aug 2014 09:45:27 +0000 Two field isolates of Rhizoctonia solani were isolated from infected paddy plants in Malaysia. These isolates were verified via ITS-rDNA analysis that yielded ~720 bp products of the ITS1-5.8S-ITS4 region, respectively. The sequenced products showed insertion and substitution incidences which may result in strain diversity and possible variation in disease severity. These strains showed some regional and host-specific relatedness via Maximum Likelihood and further phylogenetic analysis via Maximum Parsimony showed that these strains were closely related to R. solani AG1-1A (with 99-100% identity). Subsequent to strain verification and analysis, these isolates were used in the screening of twenty rice varieties for tolerance or resistance to sheath blight via mycelial plug method where both isolates (1801 and 1802) showed resistance or moderate resistance to Teqing, TETEP, and Jasmine 85. Isolate 1802 was more virulent based on the disease severity index values. This study also showed that the mycelial plug techniques were efficient in providing uniform inoculum and humidity for screening. In addition this study shows that the disease severity index is a better mode of scoring for resistance compared to lesion length. These findings will provide a solid basis for our future breeding and screening activities at the institution. Kalaivani Nadarajah, Nurfarahana Syuhada Omar, Marhamah Md. Rosli, and Ong Shin Tze Copyright © 2014 Kalaivani Nadarajah et al. All rights reserved. Retrotransposon-Based Molecular Markers for Analysis of Genetic Diversity within the Genus Linum Wed, 27 Aug 2014 11:27:15 +0000 SSAP method was used to study the genetic diversity of 22 Linum species from sections Linum, Adenolinum, Dasylinum, Stellerolinum, and 46 flax cultivars. All the studied flax varieties were distinguished using SSAP for retrotransposons FL9 and FL11. Thus, the validity of SSAP method was demonstrated for flax marking, identification of accessions in genebank collections, and control during propagation of flax varieties. Polymorphism of Fl1a, Fl1b, and Cassandra insertions were very low in flax varieties, but these retrotransposons were successfully used for the investigation of Linum species. Species clusterization based on SSAP markers was in concordance with their taxonomic division into sections Dasylinum, Stellerolinum, Adenolinum, and Linum. All species of sect. Adenolinum clustered apart from species of sect. Linum. The data confirmed the accuracy of the separation in these sections. Members of section Linum are not as closely related as members of other sections, so taxonomic revision of this section is desirable. L. usitatissimum accessions genetically distant from modern flax cultivars were revealed in our work. These accessions are of utmost interest for flax breeding and introduction of new useful traits into flax cultivars. The chromosome localization of Cassandra retrotransposon in Linum species was determined. Nataliya V. Melnikova, Anna V. Kudryavtseva, Alexander V. Zelenin, Valentina A. Lakunina, Olga Yu. Yurkevich, Anna S. Speranskaya, Alexey A. Dmitriev, Anastasia A. Krinitsina, Maxim S. Belenikin, Leonid A. Uroshlev, Anastasiya V. Snezhkina, Asiya F. Sadritdinova, Nadezda V. Koroban, Alexandra V. Amosova, Tatiana E. Samatadze, Elena V. Guzenko, Valentina A. Lemesh, Anastasya M. Savilova, Olga A. Rachinskaia, Natalya V. Kishlyan, Tatiana A. Rozhmina, Nadezhda L. Bolsheva, and Olga V. Muravenko Copyright © 2014 Nataliya V. Melnikova et al. All rights reserved. Phytoliths in Taxonomy of Phylogenetic Domains of Plants Wed, 27 Aug 2014 10:32:18 +0000 We discuss, from the aspect of phylogeny, the interrelationships of the phytolith types in plants from the main taxonomical groups (algae, lichens, horsetails, gymnosperms, and floral plants) with homologues of known proteins of biomineralization. Phytolith morphotypes in various phylogenetic plant domains have different shapes. We found that, in ancient types of plants (algae, horsetails, and gymnosperms), there are fewer different phytolith morphotypes compared to more modern plants (floral plants). The phytolith morphotypes in primitive plants are generally larger than the morphotypes in more highly organized plants. We found that the irregular ruminate and irregular smooth morphotypes are the two most frequently encountered phytolith morphotypes in the tested plants (from algae to floral plants). These two morphotypes probably have a universal role. Silacidins, silicon transporters, silicateins, silaffins, and silicase homologues are often found in the major taxonomic groups of plants. Red algae had the smallest number of homologues of the biomineralization proteins (70–80), Monocotyledonous: 142, Coniferous: 166, Mosses: 227, and Dicotyledones: 336. Kirill S. Golokhvast, Ivan V. Seryodkin, Vladimir V. Chaika, Alexander M. Zakharenko, and Igor E. Pamirsky Copyright © 2014 Kirill S. Golokhvast et al. All rights reserved. Quantitative Analysis of Pork and Chicken Products by Droplet Digital PCR Wed, 27 Aug 2014 07:58:26 +0000 In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises. Yicun Cai, Xiang Li, Rong Lv, Jielin Yang, Jian Li, Yuping He, and Liangwen Pan Copyright © 2014 Yicun Cai et al. All rights reserved. Binding Sites of miR-1273 Family on the mRNA of Target Genes Tue, 26 Aug 2014 13:27:17 +0000 This study examined binding sites of 2,578 miRNAs in the mRNAs of 12,175 human genes using the MirTarget program. It found that the miRNAs of miR-1273 family have between 33 and 1,074 mRNA target genes, with a free hybridization energy of 90% or more of its maximum value. The miR-1273 family consists of miR-1273a, miR-1273c, miR-1273d, miR-1273e, miR-1273f, miR-1273g-3p, miR-1273g-5p, miR-1273h-3p, and miR-1273h-5p. Unique miRNAs (miR-1273e, miR-1273f, and miR-1273g-3p) have more than 400 target genes. We established 99 mRNA nucleotide sequences that contain arranged binding sites for the miR-1273 family. High conservation of each miRNA binding site in the mRNA of the target genes was found. The arranged binding sites of the miR-1273 family are located in the 5′UTR, CDS, or 3′UTR of many mRNAs. Five repeating sites containing some of the miR-1273 family’s binding sites were found in the 3′UTR of several target genes. The oligonucleotide sequences of miR-1273 binding sites located in CDSs code for homologous amino acid sequences in the proteins of target genes. The biological role of unique miRNAs was also discussed. Anatoly Ivashchenko, Olga Berillo, Anna Pyrkova, and Raigul Niyazova Copyright © 2014 Anatoly Ivashchenko et al. All rights reserved. tasiRNA-ARF Pathway Moderates Floral Architecture in Arabidopsis Plants Subjected to Drought Stress Tue, 26 Aug 2014 13:24:16 +0000 In plants, miRNAs and siRNAs, such as transacting siRNAs (ta-siRNAs), affect their targets through distinct regulatory mechanisms. In this study, the expression profiles of small RNAs (smRNAs) in Arabidopsis plants subjected to drought, cold, and high-salinity stress were analyzed using 454 DNA sequencing technology. Expression of three groups of ta-siRNAs (TAS1, TAS2, and TAS3) and their precursors was downregulated in Arabidopsis plants subjected to drought and high-salinity stress. Analysis of ta-siRNA synthesis mutants and mutated ARF3-overexpressing plants that escape the tasiRNA-ARF target indicated that self-pollination was hampered by short stamens in plants under drought and high-salinity stress. Microarray analysis of flower buds of rdr6 and wild-type plants under drought stress and nonstressed conditions revealed that expression of floral development- and auxin response-related genes was affected by drought stress and by the RDR6 mutation. The overall results of the present study indicated that tasiRNA-ARF is involved in maintaining the normal morphogenesis of flowers in plants under stress conditions through fine-tuning expression changes of floral development-related and auxin response-related genes. Akihiro Matsui, Kayoko Mizunashi, Maho Tanaka, Eli Kaminuma, Anh Hai Nguyen, Maiko Nakajima, Jong-Myong Kim, Dong Van Nguyen, Tetsuro Toyoda, and Motoaki Seki Copyright © 2014 Akihiro Matsui et al. All rights reserved. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact Mon, 18 Aug 2014 08:19:35 +0000 The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. Maxim V. Zagoskin, Valentina I. Lazareva, Andrey K. Grishanin, and Dmitry V. Mukha Copyright © 2014 Maxim V. Zagoskin et al. All rights reserved. Methylation-Associated Gene Silencing of RARB in Areca Carcinogens Induced Mouse Oral Squamous Cell Carcinoma Sun, 17 Aug 2014 11:01:55 +0000 Regarding oral squamous cell carcinoma (OSCC) development, chewing areca is known to be a strong risk factor in many Asian cultures. Therefore, we established an OSCC induced mouse model by 4-nitroquinoline-1-oxide (4-NQO), or arecoline, or both treatments, respectively. These are the main two components of the areca nut that could increase the occurrence of OSCC. We examined the effects with the noncommercial MCGI (mouse CpG islands) microarray for genome-wide screening the DNA methylation aberrant in induced OSCC mice. The microarray results showed 34 hypermethylated genes in 4-NQO plus arecoline induced OSCC mice tongue tissues. The examinations also used methylation-specific polymerase chain reaction (MS-PCR) and bisulfite sequencing to realize the methylation pattern in collected mouse tongue tissues and human OSCC cell lines of different grades, respectively. These results showed that retinoic acid receptor β (RARB) was indicated in hypermethylation at the promoter region and the loss of expression during cancer development. According to the results of real-time PCR, it was shown that de novo DNA methyltransferases were involved in gene epigenetic alternations of OSCC. Collectively, our results showed that RARB hypermethylation was involved in the areca-associated oral carcinogenesis. Zi-Lun Lai, Yung-An Tsou, Shin-Ru Fan, Ming-Hsui Tsai, Hsiao-Ling Chen, Nai-Wen Chang, Ju-Chien Cheng, and Chuan-Mu Chen Copyright © 2014 Zi-Lun Lai et al. All rights reserved. The Properties of Binding Sites of miR-619-5p, miR-5095, miR-5096, and miR-5585-3p in the mRNAs of Human Genes Mon, 04 Aug 2014 11:08:23 +0000 The binding of 2,578 human miRNAs with the mRNAs of 12,175 human genes was studied. It was established that miR-619-5p, miR-5095, miR-5096, and miR-5585-3p bind with high affinity to the mRNAs of the 1215, 832, 725, and 655 genes, respectively. These unique miRNAs have binding sites in the coding sequences and untranslated regions of mRNAs. The mRNAs of many genes have multiple miR-619-5p, miR-5095, miR-5096, and miR-5585-3p binding sites. Groups of mRNAs in which the ordering of the miR-619-5p, miR-5095, miR-5096, and miR-5585-3p binding sites differ were established. The possible functional and evolutional properties of unique miRNAs are discussed. Anatoly Ivashchenko, Olga Berillo, Anna Pyrkova, Raigul Niyazova, and Shara Atambayeva Copyright © 2014 Anatoly Ivashchenko et al. All rights reserved. The Antileukemia Activity of Natural Product HQ17(3) Is Possibly Associated with Downregulation of miR-17-92 Cluster Tue, 22 Jul 2014 09:07:15 +0000 The compound 10′(Z),13′(E),15′(E)-heptadecatrienylhydroquinone [HQ17(3)] was purified from the sap of the lacquer tree Rhus succedanea. HQ17(3) has cytotoxic effect on cancer cells and can inhibit topoisomerase (topo) IIα activity. We treated various cancer cells with different doses of HQ17(3) and found that leukemia cells were most sensitive to HQ17(3). After analysis of microRNA (miRNA) profiling, we found that treatment with HQ17(3) caused downregulation of miR-17-92 cluster in some leukemia cells. These changes partially restored the normal levels from leukemia-specific miRNA expression signature. Messenger RNAs of tumor suppressor proteins, such as pRB, PTEN, and Dicer, are targets of miR-17-92 cluster. Their protein levels were increased after the treatment. c-Myc is a regulatory protein for miR-17-92 gene. Similar to topo IIα, we found that c-Myc decreased its activity after the HQ17(3) treatment, which may explain the downregulation of miR-17-92 cluster. Combined with 5-fluorouracil, NaAsO2, or ABT-737, HQ17(3) elicited additive inhibitory effects on leukemia cells. In conclusion, the high sensitivity of leukemia cells to HQ17(3) may be associated with the reduction of topo IIα and c-Myc activities, as well as with the downregulation of the miR-17-92 cluster expression. Ya-Chun Liao, Tzu-Heng Lin, Chih-Ying Chen, Shwu-Bin Lin, and Lo-Chun Au Copyright © 2014 Ya-Chun Liao et al. All rights reserved. Effects of Crude Extracts from Medicinal Herbs Rhazya stricta and Zingiber officinale on Growth and Proliferation of Human Brain Cancer Cell Line In Vitro Tue, 22 Jul 2014 07:37:49 +0000 Hitherto, limited clinical impact has been achieved in the treatment of glioblastoma (GBMs). Although phytochemicals found in medicinal herbs can provide mankind with new therapeutic remedies, single agent intervention has failed to bring the expected outcome in clinical trials. Therefore, combinations of several agents at once are gaining increasing attractiveness. In the present study, we investigated the effects of crude alkaloid (CAERS) and flavonoid (CFEZO) extracts prepared from medicinal herbs, Rhazya stricta and Zingiber officinale, respectively, on the growth of human GBM cell line, U251. R. stricta and Z. officinale are traditionally used in folkloric medicine and have antioxidant, anticarcinogenic, and free radical scavenging properties. Combination of CAERS and CFEZO treatments synergistically suppressed proliferation and colony formation and effectively induced morphological and biochemical features of apoptosis in U251 cells. Apoptosis induction was mediated by release of mitochondrial cytochrome c, increased Bax : Bcl-2 ratio, enhanced activities of caspase-3 and -9, and PARP-1 cleavage. CAERS and CFEZO treatments decreased expression levels of nuclear NF-κBp65, survivin, XIAP, and cyclin D1 and increased expression level of p53, p21, and Noxa. These results suggest that combination of CAERS and CFEZO provides a useful foundation for studying and developing novel chemotherapeutic agents for the treatment of GBM. Ayman I. Elkady, Rania Abd El Hamid Hussein, and Osama A. Abu-Zinadah Copyright © 2014 Ayman I. Elkady et al. All rights reserved. Protein Kinase D3 Is Essential for Prostratin-Activated Transcription of Integrated HIV-1 Provirus Promoter via NF-κB Signaling Pathway Mon, 21 Jul 2014 00:00:00 +0000 Prostratin has been proposed as a promising reagent for eradicating the latent HIV-1 provirus by inducing HIV-1 transcription activation. The molecular mechanism of this activation, however, is far from clear. Here, we show that the protein kinase D3 (PKD3) is essential for prostratin-induced transcription activation of latent HIV-1 provirus. First, silencing PKD3, but not the other members of PKD family, blocked prostratin-induced transcription of HIV-1. Second, overexpressing the constitutively active form of PKD3, but not the wild-type or kinase-dead form of PKD3, augmented the expression of HIV-1. Consistent with this observation, we found that prostratin could trigger PKD3 activation by inducing the phosphorylation of its activation loop. In addition, we identified PKC of the novel PKC subfamily as the upstream kinase for this phosphorylation. Finally, the activation effect of PKD3 on HIV-1 transcription was shown to depend on the presence of κB element and the prostratin-induced activation of NF-κB, as indicated by the fact that silencing PKD3 blocked prostratin-induced NF-κB activation and NF-κB-dependent HIV-1 transcription. Therefore, for the first time, PKD3 is implicated in the transcription activation of latent HIV-1 provirus, and our results revealed a molecular mechanism of prostratin-induced HIV-1 transcription via PKC/PKD3/NF-κB signaling pathway. Huiping Wang, Xinxing Zhu, Ying Zhu, Jiangfang Liu, Xiangming Hu, Yu Wang, Sijia Peng, Yanheng Chen, Ruichuan Chen, Feng Ding, and Runzhong Liu Copyright © 2014 Huiping Wang et al. All rights reserved. Recent Advances in Polyamine Metabolism and Abiotic Stress Tolerance Sun, 20 Jul 2014 00:00:00 +0000 Global warming is an alarming problem in agriculture and its effect on yield loss has been estimated to be five per cent for every degree centigrade rise in temperature. Plants exhibit multiple mechanisms like optimizing signaling pathway, involvement of secondary messengers, production of biomolecules specifically in response to stress, modulation of various metabolic networks in accordance with stress, and so forth, in order to overcome abiotic stress factors. Many structural genes and networks of pathway were identified and reported in plant systems for abiotic stress tolerance. One such crucial metabolic pathway that is involved in normal physiological function and also gets modulated during stress to impart tolerance is polyamine metabolic pathway. Besides the role of structural genes, it is also important to know the mechanism by which these structural genes are regulated during stress. Present review highlights polyamine biosynthesis, catabolism, and its role in abiotic stress tolerance with special reference to plant systems. Additionally, a system based approach is discussed as a potential strategy to dissect the existing variation in crop species in unraveling the interacting regulatory components/genetic determinants related to PAs mediated abiotic stress tolerance. Parimalan Rangan, Rajkumar Subramani, Rajesh Kumar, Amit Kumar Singh, and Rakesh Singh Copyright © 2014 Parimalan Rangan et al. All rights reserved. Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa Mon, 14 Jul 2014 08:11:51 +0000 Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. Seow-Neng Chan, Norliza Abu Bakar, Maziah Mahmood, Chai-Ling Ho, and Noor Azmi Shaharuddin Copyright © 2014 Seow-Neng Chan et al. All rights reserved. Analysis of Differential miRNA Expression in Primary Tumor and Stroma of Colorectal Cancer Patients Thu, 10 Jul 2014 00:00:00 +0000 Microarray technology was used to profile miRNA expression in primary tumor and stromal tissue from paraffin embedded material of 51 patients with colorectal cancer. 26 miRNAs resulted differentially expressed with at least 2-fold change in tumor tissue with respect to stroma (16 more expressed in the tumor and 10 more expressed in the stroma). 10/26 were confirmed as differentially expressed at qRTPCR: miR-200c-3p, miR-141-3p, miR-200b-3p, miR-200a-3p, miR-1246, miR-92a-3p, miR-194-5p, miR-192-5p, miR-3651-5p, and miR-574-3p. No significant association was found between miRNA expressions and stage at diagnosis, site of primary tumor, first site of metastasis, progression-free, or overall survival. Giuseppina Della Vittoria Scarpati, Enrica Calura, Mariacristina Di Marino, Chiara Romualdi, Luca Beltrame, Umberto Malapelle, Giancarlo Troncone, Alfonso De Stefano, Stefano Pepe, Sabino De Placido, Maurizio D'Incalci, Sergio Marchini, and Chiara Carlomagno Copyright © 2014 Giuseppina Della Vittoria Scarpati et al. All rights reserved. Cloning, Expression, Purification, and Characterization of Glutaredoxin from Antarctic Sea-Ice Bacterium Pseudoalteromonas sp. AN178 Mon, 07 Jul 2014 11:06:23 +0000 Glutaredoxins (Grxs) are small ubiquitous redox enzymes that catalyze glutathione-dependent reactions to reduce protein disulfide. In this study, a full-length Grx gene (PsGrx) with 270 nucleotides was isolated from Antarctic sea-ice bacterium Pseudoalteromonas sp. AN178. It encoded deduced 89 amino acid residues with the molecular weight 9.8 kDa. Sequence analysis of the amino acid sequence revealed the catalytic motif CPYC. Recombinant PsGrx (rPsGrx) stably expressed in E. coli BL21 was purified to apparent homogeneity by Ni-affinity chromatography. rPsGrx exhibited optimal activity at 30°C and pH 8.0 and showed 25.5% of the activity at 0°C. It retained 65.0% of activity after incubation at 40°C for 20 min and still exhibited 37.0% activity in 1.0 M NaCl. These results indicated that rPsGrx was a typical cold active protein with low thermostability. Quanfu Wang, Yanhua Hou, Yonglei Shi, Xiao Han, Qian Chen, Zhiguo Hu, Yuanping Liu, and YuJin Li Copyright © 2014 Quanfu Wang et al. All rights reserved. Comparison of Two Methods of RNA Extraction from Formalin-Fixed Paraffin-Embedded Tissue Specimens Thu, 03 Jul 2014 11:50:46 +0000 The present study aimed to compare two different methods of extracting RNA from formalin-fixed paraffin-embedded (FFPE) specimens of diffuse large B-cell lymphoma (DLBCL). We further aimed to identify possible influences of variables—such as tissue size, duration of paraffin block storage, fixative type, primers used for cDNA synthesis, and endogenous genes tested—on the success of amplification from the samples. Both tested protocols used the same commercial kit for RNA extraction (the RecoverAll Total Nucleic Acid Isolation Optimized for FFPE Samples from Ambion). However, the second protocol included an additional step of washing with saline buffer just after sample rehydration. Following each protocol, we compared the RNA amount and purity and the amplification success as evaluated by standard PCR and real-time PCR. The results revealed that the extra washing step added to the RNA extraction process resulted in significantly improved RNA quantity and quality and improved success of amplification from paraffin-embedded specimens. Gisele Rodrigues Gouveia, Suzete Cleusa Ferreira, Jerenice Esdras Ferreira, Sheila Aparecida Coelho Siqueira, and Juliana Pereira Copyright © 2014 Gisele Rodrigues Gouveia et al. All rights reserved. Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome Wed, 02 Jul 2014 07:43:10 +0000 Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN) is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt) may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome. Chih-Jie Shen, Yung-An Tsou, Hsiao-Ling Chen, Hung-Jin Huang, Shinn-Chih Wu, Winston T. K. Cheng, Calvin Yu-Chian Chen, and Chuan-Mu Chen Copyright © 2014 Chih-Jie Shen et al. All rights reserved. Potential Smoothened Inhibitor from Traditional Chinese Medicine against the Disease of Diabetes, Obesity, and Cancer Tue, 01 Jul 2014 07:03:00 +0000 Nowadays, obesity becomes a serious global problem, which can induce a series of diseases such as type 2 diabetes mellitus, cancer, cardiovascular disease, metabolic syndrome, and stoke. For the mechanisms of diseases, the hedgehog signaling pathway plays an important role in body patterning during embryogenesis. For this reason, smoothened homologue (Smo) protein had been indicated as the drug target. In addition, the small-molecule Smo inhibitor had also been used in oncology clinical trials. To improve drug development of TCM compounds, we aim to investigate the potent lead compounds as Smo inhibitor from the TCM compounds in TCM Database@Taiwan. The top three TCM compounds, precatorine, labiatic acid, and 2,2′-[benzene-1,4-diylbis(methanediyloxybenzene-4,1-diyl)]bis(oxoacetic acid), have displayed higher potent binding affinities than the positive control, LY2940680, in the docking simulation. After MD simulations, which can optimize the result of docking simulation and validate the stability of H-bonds between each ligand and Smo protein under dynamic conditions, top three TCM compounds maintain most of interactions with Smo protein, which keep the ligand binding stable in the binding domain. Hence, we propose precatorine, labiatic acid, and 2,2′-[benzene-1,4-diylbis(methanediyloxybenzene-4,1-diyl)]bis(oxoacetic acid) as potential lead compounds for further study in drug development process with the Smo protein. Kuan-Chung Chen, Mao-Feng Sun, Hsin-Yi Chen, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Kuan-Chung Chen et al. All rights reserved. Investigation of Estrogen Receptor (ESR1) for Breast Cancer from Traditional Chinese Medicine Thu, 26 Jun 2014 10:22:36 +0000 Recently, an important topic of breast cancer had been published in 2013. In this report, estrogen receptor (ESR1) had defined the relation of hormone-cause breast cancer. The screening of traditional Chinese medicine (TCM) database has found the molecular compounds by simulating molecular docking and molecular dynamics to regulate ESR1. S-Allylmercaptocysteine and 5-hydroxy-L-tryptophan are selected according to the highest docking score than that of other TCM compounds and Raloxifene (control). The simulation from molecular dynamics is helpful in analyzing and detecting the protein-ligand interactions. After a comparing the control and the Apo form, then based on the docking poses, hydrophobic interactions, hydrogen bond and structure variations, this research postulates that S-allylmercaptocysteine may be more appropriate than other compounds for protein-ligand interaction. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Muscle-Type Specific Autophosphorylation of CaMKII Isoforms after Paced Contractions Thu, 26 Jun 2014 08:42:27 +0000 We explored to what extent isoforms of the regulator of excitation-contraction and excitation-transcription coupling, calcium/calmodulin protein kinase II (CaMKII) contribute to the specificity of myocellular calcium sensing between muscle types and whether concentration transients in its autophosphorylation can be simulated. CaMKII autophosphorylation at Thr287 was assessed in three muscle compartments of the rat after slow or fast motor unit-type stimulation and was compared against a computational model (CaMuZclE) coupling myocellular calcium dynamics with CaMKII Thr287 phosphorylation. Qualitative differences existed between fast- (gastrocnemius medialis) and slow-type muscle (soleus) for the expression pattern of CaMKII isoforms. Phospho-Thr287 content of δA CaMKII, associated with nuclear functions, demonstrated a transient and compartment-specific increase after excitation, which contrasted to the delayed autophosphorylation of the sarcoplasmic reticulum-associated βM CaMKII. In soleus muscle, excitation-induced δA CaMKII autophosphorylation demonstrated frequency dependence (P = 0.02). In the glycolytic compartment of gastrocnemius medialis, CaMKII autophosphorylation after excitation was blunted. In silico assessment emphasized the importance of mitochondrial calcium buffer capacity for excitation-induced CaMKII autophosphorylation but did not predict its isoform specificity. The findings expose that CaMKII autophosphorylation with paced contractions is regulated in an isoform and muscle type-specific fashion and highlight properties emerging for phenotype-specific regulation of CaMKII. Wouter Eilers, Wouter Gevers, Daniëlle van Overbeek, Arnold de Haan, Richard T. Jaspers, Peter A. Hilbers, Natal van Riel, and Martin Flück Copyright © 2014 Wouter Eilers et al. All rights reserved. CELLCOUNTER: Novel Open-Source Software for Counting Cell Migration and Invasion In Vitro Thu, 26 Jun 2014 07:33:01 +0000 Transwell Boyden chamber based migration/invasion assay is a simple and extensively used approach for the characterization of cell motility in vitro. Cell motility is quantified by counting the number of cells that pass through the filter membrane. The counting is usually performed manually, which is laborious and error prone. We have therefore developed CELLCOUNTER, an application that is capable of recognizing and counting the total number of cells through an intuitive graphical user interface. The counting can be performed in batch, and the counting results can be visualized and further curated manually. CELLCOUNTER will be helpful in streamlining the experimental process and improving the reliability of the data acquisition. Xiaoni Li, Hongshun Yang, Hailiang Huang, and Tao Zhu Copyright © 2014 Xiaoni Li et al. All rights reserved. In Silico Investigation of Potential TRAF6 Inhibitor from Traditional Chinese Medicine against Cancers Wed, 25 Jun 2014 13:23:11 +0000 It has been indicated that tumor necrosis factor receptor-associated factor-6 (TRAF6) will upregulate the expression of hypoxia-inducible factor-1α (HIF-1α) and promote tumor angiogenesis. TRAF6 proteins can be treated as drug target proteins for a differentiation therapy against cancers. As structural disordered disposition in the protein may induce the side-effect and reduce the occupancy for ligand to bind with target protein, PONDR-Fit protocol was performed to predict the disordered disposition in TRAF6 protein before virtual screening. TCM compounds from the TCM Database@Taiwan were employed for virtual screening to identify potent compounds as lead compounds of TRAF6 inhibitor. After virtual screening, the MD simulation was performed to validate the stability of interactions between TRAF6 proteins and each ligand. The top TCM compounds, tryptophan, diiodotyrosine, and saussureamine C, extracted from Saussurea lappa Clarke, Bos taurus domesticus Gmelin, and Lycium chinense Mill., have higher binding affinities with target protein in docking simulation. However, the docking pose of TRAF6 protein with tryptophan is not stable under dynamic condition. For the other two TCM candidates, diiodotyrosine and saussureamine C maintain the similar docking poses under dynamic conditions. Hence, we propose the TCM compounds, diiodotyrosine and saussureamine C, as potential candidates as lead compounds for further study in drug development process with the TRAF6 protein against cancer. Kuan-Chung Chen, Wen-Yuan Lee, Hsin-Yi Chen, and Calvin Yu-Chian Chen Copyright © 2014 Kuan-Chung Chen et al. All rights reserved. In Silico Investigation of Potential Pyruvate Kinase M2 Regulators from Traditional Chinese Medicine against Cancers Wed, 25 Jun 2014 09:37:22 +0000 A recent research in cancer research demonstrates that tumor-specific pyruvate kinase M2 (PKM2) plays an important role in chromosome segregation and mitosis progression of tumor cells. To improve the drug development of TCM compounds, we aim to identify potent TCM compounds as lead compounds of PKM2 regulators. PONDR-Fit protocol was utilized to predict the disordered disposition in the binding domain of PKM2 protein before virtual screening as the disordered structure in the protein may cause the side effect and downregulation of the possibility of ligand to bind with target protein. MD simulation was performed to validate the stability of interactions between PKM2 proteins and each ligand after virtual screening. The top TCM compounds, saussureamine C and precatorine, extracted from Lycium chinense Mill. and Abrus precatorius L., respectively, have higher binding affinities with target protein in docking simulation than control. They have stable H-bonds with residues A:Lys311 and some other residues in both chains of PKM2 protein. Hence, we propose the TCM compounds, saussureamine C and precatorine, as potential candidates as lead compounds for further study in drug development process with the PKM2 protein against cancer. Kuan-Chung Chen, Kuen-Bao Chen, Hsin-Yi Chen, and Calvin Yu-Chian Chen Copyright © 2014 Kuan-Chung Chen et al. All rights reserved. In Silico Investigation of Traditional Chinese Medicine Compounds to Inhibit Human Histone Deacetylase 2 for Patients with Alzheimer’s Disease Mon, 23 Jun 2014 12:14:33 +0000 Human histone deacetylase 2 (HDAC2) has been identified as being associated with Alzheimer’s disease (AD), a neuropathic degenerative disease. In this study, we screen the world’s largest Traditional Chinese Medicine (TCM) database for natural compounds that may be useful as lead compounds in the search for inhibitors of HDAC2 function. The technique of molecular docking was employed to select the ten top TCM candidates. We used three prediction models, multiple linear regression (MLR), support vector machine (SVM), and the Bayes network toolbox (BNT), to predict the bioactivity of the TCM candidates. Molecular dynamics simulation provides the protein-ligand interactions of compounds. The bioactivity predictions of pIC50 values suggest that the TCM candidatesm, (−)-Bontl ferulate, monomethylcurcumin, and ningposides C, have a greater effect on HDAC2 inhibition. The structure variation caused by the hydrogen bonds and hydrophobic interactions between protein-ligand interactions indicates that these compounds have an inhibitory effect on the protein. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. In Silico Investigation of Potential mTOR Inhibitors from Traditional Chinese Medicine for Treatment of Leigh Syndrome Mon, 23 Jun 2014 11:28:49 +0000 A recent research demonstrates that the inhibition of mammalian target of rapamycin (mTOR) improves survival and health for patients with Leigh syndrome. mTOR proteins can be treated as drug target proteins against Leigh syndrome and other mitochondrial disorders. In this study, we aim to identify potent TCM compounds from the TCM Database@Taiwan as lead compounds of mTOR inhibitors. PONDR-Fit protocol was employed to predict the disordered disposition in mTOR protein before virtual screening. After virtual screening, the MD simulation was employed to validate the stability of interactions between each ligand and mTOR protein in the docking poses from docking simulation. The top TCM compounds, picrasidine M and acerosin, have higher binding affinities with target protein in docking simulation than control. There have H-bonds with residues Val2240 and π interactions with common residue Trp2239. After MD simulation, the top TCM compounds maintain similar docking poses under dynamic conditions. The top two TCM compounds, picrasidine M and acerosin, were extracted from Picrasma quassioides (D. Don) Benn. and Vitex negundo L. Hence, we propose the TCM compounds, picrasidine M and acerosin, as potential candidates as lead compounds for further study in drug development process with the mTOR protein against Leigh syndrome and other mitochondrial disorders. Kuan-Chung Chen, Wen-Yuan Lee, Hsin-Yi Chen, and Calvin Yu-Chian Chen Copyright © 2014 Kuan-Chung Chen et al. All rights reserved. Extended Genetic Diversity of Bovine Viral Diarrhea Virus and Frequency of Genotypes and Subtypes in Cattle in Italy between 1995 and 2013 Sun, 22 Jun 2014 13:26:24 +0000 Genetic typing of bovine viral diarrhea virus (BVDV) has distinguished BVDV-1 and BVDV-2 species and an emerging putative third species (HoBi-like virus), recently detected in southern Italy, signaling the occurrence of natural infection in Europe. Recognizing the need to update the data on BVDV genetic variability in Italy for mounting local and European alerts, a wide collection of UTR sequences (n = 371) was selected to identify the frequency of genotypes and subtypes at the herd level. BVDV-1 had the highest frequency, followed by sporadic BVDV-2. No novel HoBi-like viruses were identified. Four distribution patterns of BVDV-1 subtypes were observed: highly prevalent subtypes with a wide temporal-spatial distribution (1b and 1e), low prevalent subtypes with a widespread geographic distribution (1a, 1d, 1g, 1h, and 1k) or a restricted geographic distribution (1f), and sporadic subtypes detected only in single herds (1c, 1j, and 1l). BVDV-1c, k, and l are reported for the first time in Italy. A unique genetic variant was detected in the majority of herds, but cocirculation of genetic variants was also observed. Northern Italy ranked first for BVDV introduction, prevalence, and dispersion. Nevertheless, the presence of sporadic variants in other restricted areas suggests the risk of different routes of BVDV introduction. Camilla Luzzago, Stefania Lauzi, Erika Ebranati, Monica Giammarioli, Ana Moreno, Vincenza Cannella, Loretta Masoero, Elena Canelli, Annalisa Guercio, Claudio Caruso, Massimo Ciccozzi, Gian Mario De Mia, Pier Luigi Acutis, Gianguglielmo Zehender, and Simone Peletto Copyright © 2014 Camilla Luzzago et al. All rights reserved. Treatment of Cardiovascular Disease by Traditional Chinese Medicine against Pregnane X Receptor Sun, 22 Jun 2014 06:00:21 +0000 Recently, cardiovascular disease, also known as loop circulatory system diseases or disorders, is one of the serious diseases including heart disease, stroke, atherosclerosis, myocardial infarction, hypertension, hypotension, and thrombosis. Human pregnane X receptor, PXR, plays a crucial role in exogenous and endobiotic metabolism for rabbit, rat, mouse, and human. The PXR activation can protect the blood vessels from damage of hazardous substances. In this study we aim to investigate the potent lead compounds as PXR receptor agonist against cardiovascular disease. To improve drug development of TCM compounds, we aim to investigate the potent lead compounds as PXR agonists from the TCM compounds in TCM Database@Taiwan. The top three TCM compounds, bis(4-hydroxybenzyl) ether mono-β-D-glucopyranoside (BEMG), ixerisoside, and tangshenoside II, have displayed higher potent binding affinities than the positive control, PNU-142721, in the docking simulation. After MD simulations, which can optimize the result of docking simulation and validate the stability of H-bonds between each ligand and PXR protein under dynamic conditions, top TCM compounds, BEMG and tangshenoside II, maintain most of interactions with PXR protein, which keep the ligand binding stable in the binding domain. Hence, we propose BEMG and tangshenoside II as potential lead compounds for further study in drug development process with the PXR protein. Kuen-Bao Chen, Hsin-Yi Chen, Kuan-Chung Chen, and Calvin Yu-Chian Chen Copyright © 2014 Kuen-Bao Chen et al. All rights reserved. Drug Design of Cyclin-Dependent Kinase 2 Inhibitor for Melanoma from Traditional Chinese Medicine Thu, 19 Jun 2014 15:43:40 +0000 One has found an important cell cycle controller. This guard can decide the cell cycle toward proliferation or quiescence. Cyclin-dependent kinase 2 (CDK2) is a unique target among the CDK family in melanoma therapy. We attempted to find out TCM compounds from TCM Database@Taiwan that have the ability to inhibit the activity of CDK2 by systems biology. We selected Tetrahydropalmatine, Reserpiline, and (+)-Corydaline as the candidates by docking and screening results for further survey. We utilized support vector machine (SVM), multiple linear regression (MLR) models and Bayesian network for validation of predicted activity. By overall analysis of docking results, predicted activity, and molecular dynamics (MD) simulation, we could conclude that Tetrahydropalmatine, Reserpiline, and (+)-Corydaline had better binding affinity than the control. All of them had the ability to inhibit the activity of CDK2 and might have the opportunity to be applied in melanoma therapy. Hsin-Chieh Tang and Calvin Yu-Chian Chen Copyright © 2014 Hsin-Chieh Tang and Calvin Yu-Chian Chen. All rights reserved. An Investigation of Small GTPases in relation to Liver Tumorigenesis Using Traditional Chinese Medicine Thu, 19 Jun 2014 15:42:00 +0000 Recently, an important topic of liver tumorigenesis had been published in 2013. In this report, Ras and Rho had defined the relation of liver tumorigenesis. The traditional Chinese medicine (TCM) database has been screened for molecular compounds by simulating molecular docking and molecular dynamics to regulate Ras and liver tumorigenesis. Saussureamine C, S-allylmercaptocysteine, and Tryptophan are selected based on the highest docking score than other TCM compounds. The molecular dynamics are helpful in the analysis and detection of protein-ligand interactions. Based on the docking poses, hydrophobic interactions, and hydrogen bond variations, this research surmises are the main regions of important amino acids in Ras. In addition to the detection of TCM compound efficacy, we suggest Saussureamine C is better than the others for protein-ligand interaction. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. The Inhibition of Folylpolyglutamate Synthetase (folC) in the Prevention of Drug Resistance in Mycobacterium tuberculosis by Traditional Chinese Medicine Thu, 19 Jun 2014 07:35:48 +0000 Tuberculosis (TB) is an infectious disease caused by many strains of mycobacteria, but commonly Mycobacterium tuberculosis. As a possible method of reducing the drug resistance of M. tuberculosis, this research investigates the inhibition of Folylpolyglutamate synthetase, a protein transcript from the resistance association gene folC. After molecular docking to screen the traditional Chinese medicine (TCM) database, the candidate TCM compounds, with Folylpolyglutamate synthetase, were selected by molecular dynamics. The 10,000 ps simulation in association with RMSD analysis and total energy and structural variation defined the protein-ligand interaction. The selected TCM compounds Saussureamine C, methyl 3-O-feruloylquinate, and Labiatic acid have been found to inhibit the activity of bacteria and viruses and to regulate immunity. We also suggest the possible pathway in protein for each ligand. Compared with the control, similar interactions and structural variations indicate that these compounds might have an effect on Folylpolyglutamate synthetase. Finally, we suggest Saussureamine C is the best candidate compound as the complex has a high score, maintains its structural composition, and has a larger variation value than the control, thus inhibiting the drug resistance ability of Mycobacterium tuberculosis. Tzu-Chieh Hung, Kuen-Bao Chen, Wen-Yuan Lee, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Possible Inhibitor from Traditional Chinese Medicine for the β Form of Calcium-Dependent Protein Kinase Type II in the Treatment of Major Depressive Disorder Wed, 18 Jun 2014 09:30:30 +0000 Recently, an important topic of major depressive disorder (MDD) had been published in 2013. MDD is one of the most prevalent and disabling mental disorders. Consequently, much research is being undertaken into the causes and treatment. It has been found that inhibition of the β form of calcium/calmodulin-dependent protein kinase type II (β-CaMKII) can ameliorate the disorder. Upon screening the traditional Chinese medicine (TCM) database by molecular docking, sengesterone, labiatic acid, and methyl 3-O-feruloylquinate were selected for molecular dynamics. After 20 ns simulation, the RMSD, total energy, and structure variation could define the protein-ligand interaction. Furthermore, sengesterone, the principle candidate compound, has been found to have an effect on the regulation of emotions and memory development. In structure variation, we find the sample functional group of important amino acids make the protein stable and have limited variation. Due to similarity of structure variations, we suggest that these compounds may have an effect on β-CaMKII and that sengesterone may have a similar efficacy as the control. However labiatic acid may be a stronger inhibitor of β-CaMKII based on the larger RMSD and variation. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Hung-Jin Huang, Yueh-Chiu Chan, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Insight into HIV of IFN-Induced Myxovirus Resistance 2 (MX2) Expressed by Traditional Chinese Medicine Wed, 18 Jun 2014 08:21:54 +0000 Recently, an important topic of the acquired immunodeficiency syndrome (AIDS) had been published in 2013. In this report, the expression of the IFN-induced myxovirus resistance 2 (MX2) had been defined the function to kill the human immunodeficiency virus (HIV). The screening from the Traditional Chinese Medicine (TCM) database by simulating molecular docking and molecular dynamics could select candidate compounds, which may express MX2 against HIV. Saussureamine C, Crotalaburnine, and Precatorine are selected based on the highest docking score and other TCM compounds. The data from molecular dynamics are helpful in the analysis and detection of protein-ligand interactions. According to the docking poses, hydrophobic interactions, and hydrogen bond with structure variations, this research could assess the interaction between protein and ligand interaction. In addition to the detection of TCM compound efficacy, we suggest that Saussureamine C is better than the others in protein-ligand interaction and the structural variation to express MX2. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Sequence-Based Appraisal of the Genes Encoding Neck and Carbohydrate Recognition Domain of Conglutinin in Blackbuck (Antilope cervicapra) and Goat (Capra hircus) Mon, 16 Jun 2014 09:24:53 +0000 Conglutinin, a collagenous C-type lectin, acts as soluble pattern recognition receptor (PRR) in recognition of pathogens. In the present study, genes encoding neck and carbohydrate recognition domain (NCRD) of conglutinin in goat and blackbuck were amplified, cloned, and sequenced. The obtained 488 bp ORFs encoding NCRD were submitted to NCBI with accession numbers KC505182 and KC505183. Both nucleotide and predicted amino acid sequences were analysed with sequences of other ruminants retrieved from NCBI GenBank using DNAstar and Megalign5.2 software. Sequence analysis revealed maximum similarity of blackbuck sequence with wild ruminants like nilgai and buffalo, whereas goat sequence displayed maximum similarity with sheep sequence at both nucleotide and amino acid level. Phylogenetic analysis further indicated clear divergence of wild ruminants from the domestic ruminants in separate clusters. The predicted secondary structures of NCRD protein in goat and blackbuck using SWISSMODEL ProtParam online software were found to possess 6 beta-sheets and 3 alpha-helices which are identical to the result obtained in case of sheep, cattle, buffalo, and nilgai. However, quaternary structure in goat, sheep, and cattle was found to differ from that of buffalo, nilgai, and blackbuck, suggesting a probable variation in the efficiency of antimicrobial activity among wild and domestic ruminants. Sasmita Barik, Chandra Mohan Sidappa, Mohini Saini, Ramesh Doreswamy, Asit Das, Anil K. Sharma, and Praveen K. Gupta Copyright © 2014 Sasmita Barik et al. All rights reserved. Phosphate/Zinc Interaction Analysis in Two Lettuce Varieties Reveals Contrasting Effects on Biomass, Photosynthesis, and Dynamics of Pi Transport Sun, 15 Jun 2014 12:09:05 +0000 Inorganic phosphate (Pi) and Zinc (Zn) are essential nutrients for normal plant growth. Interaction between these elements has been observed in many crop plants. Despite its agronomic importance, the biological significance and genetic basis of this interaction remain largely unknown. Here we examined the Pi/Zn interaction in two lettuce (Lactuca sativa) varieties, namely, “Paris Island Cos” and “Kordaat.” The effects of variation in Pi and Zn supply were assessed on biomass and photosynthesis for each variety. Paris Island Cos displayed better growth and photosynthesis compared to Kordaat under all the conditions tested. Correlation analysis was performed to determine the interconnectivity between Pi and Zn intracellular contents in both varieties. Paris Island Cos showed a strong negative correlation between the accumulation levels of Pi and Zn in shoots and roots. However, no relation was observed for Kordaat. The increase of Zn concentration in the medium causes a decrease in dynamics of Pi transport in Paris Island Cos, but not in Kordaat plants. Taken together, results revealed a contrasting behavior between the two lettuce varieties in terms of the coregulation of Pi and Zn homeostasis and provided evidence in favor of a genetic basis for the interconnection of these two elements. Nadia Bouain, Mushtak Kisko, Aida Rouached, Myriam Dauzat, Benoit Lacombe, Nibras Belgaroui, Tahar Ghnaya, Jean-Claude Davidian, Pierre Berthomieu, Chedly Abdelly, and Hatem Rouached Copyright © 2014 Nadia Bouain et al. All rights reserved. Evaluation of Correlation of Cell Cycle Proteins and Ki-67 Interaction in Paranasal Sinus Inverted Papilloma Prognosis and Squamous Cell Carcinoma Transformation Thu, 12 Jun 2014 12:53:58 +0000 The recurrent sinonasal inverted papilloma (IP) could be transformed to sinonasal squamous cell carcinoma. We use protein expression patterns by immunohistochemical method to see whether the expression of p53, p16, p21, and p27 belongs to cell-cycle-regulators and PCNA (proliferating cell nuclear antigen) and Ki-67 the proliferation markers in sixty patients with sinonasal inverted papilloma, and 10 of them with squamous cell carcinoma transformation. Significantly elevated levels of Ki-67, p27, and PCNA in IP with squamous cell carcinoma transformation of sinonasal tract compared with inverted papilloma were revealed. No variation of p16, p21, PLUNC (palate, lung, and nasal epithelium clone protein) and p53 expression was correlated to sinonasal IP malignant transformation by multivariate survey. However, we found elevated PLUNC expression in IPs with multiple recurrences. Finally, we found that PCNA, p27 may interact with CDK1 which promote IP cell proliferation and correlate to sinonasal squamous cell carcinoma. Ki-67 could work throughout the cell cycles to cause malignant transformation. In conclusion, this is a first study showing the correlation of Ki-67, PCNA interacted with CDK1 might lead to malignant transformation. Elevated PLUNC expression in the sinonasal IPs was related to multiple recurrences in human. Yung-An Tsou, Hung-Jin Huang, Tang-Chuan Wang, Chih-Jaan Tai, Chuan-Mu Chen, and Calvin Yu-Chian Chen Copyright © 2014 Yung-An Tsou et al. All rights reserved. Investigation of Potent Lead for Acquired Immunodeficiency Syndrome from Traditional Chinese Medicine Thu, 12 Jun 2014 11:47:14 +0000 Acquired immunodeficiency syndrome (AIDS), caused by human immunodeficiency virus (HIV), has become, because of the rapid spread of the disease, a serious global problem and cannot be treated. Recent studies indicate that VIF is a protein of HIV to prevent all of human immunity to attack HIV. Molecular compounds of traditional Chinese medicine (TCM) database filtered through molecular docking and molecular dynamics simulations to inhibit VIF can protect against HIV. Glutamic acid, plantagoguanidinic acid, and Aurantiamide acetate based docking score higher with other TCM compounds selected. Molecular dynamics are useful for analysis and detection ligand interactions. According to the docking position, hydrophobic interactions, hydrogen bonding changes, and structure variation, the study try to select the efficacy of traditional Chinese medicine compound Aurantiamide acetate is better than the other for protein-ligand interactions to maintain the protein composition, based on changes in the structure. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Apoptosis and Molecular Targeting Therapy in Cancer Thu, 12 Jun 2014 08:22:29 +0000 Apoptosis is the programmed cell death which maintains the healthy survival/death balance in metazoan cells. Defect in apoptosis can cause cancer or autoimmunity, while enhanced apoptosis may cause degenerative diseases. The apoptotic signals contribute into safeguarding the genomic integrity while defective apoptosis may promote carcinogenesis. The apoptotic signals are complicated and they are regulated at several levels. The signals of carcinogenesis modulate the central control points of the apoptotic pathways, including inhibitor of apoptosis (IAP) proteins and FLICE-inhibitory protein (c-FLIP). The tumor cells may use some of several molecular mechanisms to suppress apoptosis and acquire resistance to apoptotic agents, for example, by the expression of antiapoptotic proteins such as Bcl-2 or by the downregulation or mutation of proapoptotic proteins such as BAX. In this review, we provide the main regulatory molecules that govern the main basic mechanisms, extrinsic and intrinsic, of apoptosis in normal cells. We discuss how carcinogenesis could be developed via defective apoptotic pathways or their convergence. We listed some molecules which could be targeted to stimulate apoptosis in different cancers. Together, we briefly discuss the development of some promising cancer treatment strategies which target apoptotic inhibitors including Bcl-2 family proteins, IAPs, and c-FLIP for apoptosis induction. Mohamed Hassan, Hidemichi Watari, Ali AbuAlmaaty, Yusuke Ohba, and Noriaki Sakuragi Copyright © 2014 Mohamed Hassan et al. All rights reserved. Lead Screening for HIV-1 Integrase (IN) Inhibited by Traditional Chinese Medicine Wed, 11 Jun 2014 09:13:44 +0000 Human immunodeficiency virus causes the acquired immunodeficiency syndrome (AIDS) and becomes a serious world-wide problem because of this disease's rapid propagation and incurability. Integrase strand transfer inhibitors (INSTIs) supports HIV have rapid drug resistance for antitreatment. Screening the traditional Chinese medicine (TCM) database by simulating molecular docking and molecular dynamics may select molecular compounds to inhibit INSTIs against HIV drug resistance. (S)-cathinone and (1S,2S)-norpseudoephedrine are selected based on structure and ligand-based drugs are designed and then get higher bioactivity predicted score from SVM than Raltegravir and other TCM compounds. The molecular dynamics are helpful in the analysis and detection of protein-ligand interactions. According to the docking poses, hydrophobic interactions and hydrogen bond variations define the main regions of important amino acids in integrase. In addition to the detection of TCM compound efficacy, we suggest (1S,2S)-norpseudoephedrine is better than the others based on the analysis of interaction and the effect on the structural variation. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, Yueh-Chiu Chan, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Lead Screening for CXCR4 of the Human HIV Infection Receptor Inhibited by Traditional Chinese Medicine Thu, 05 Jun 2014 15:58:05 +0000 The acquired immunodeficiency syndrome (AIDS) is a serious worldwide disease caused by the human immunodeficiency virus (HIV) infection. Recent research has pointed out that the G protein-coupled chemokine receptor CXCR4 and the coreceptor C-C chemokine receptor type 5 (CCR5) are important targets for HIV infection. The traditional Chinese medicine (TCM) database has been screened for candidate compounds by simulating molecular docking and molecular dynamics against HIV. Saussureamine C, 5-hydroxy-L-tryptophan, and diiodotyrosine are selected based on the highest docking score. The molecular dynamics is helpful in the analysis and detection of protein-ligand interactions. According to the analysis of docking poses, hydrophobic interactions, hydrogen bond variations, and the comparison of the effect on CXCR4 and CCR5, these results indicate Saussureamine C may have better effect on these two receptors. But for some considerations, diiodotyrosine could make the largest variation and may have some efficacy contrary to expectations. Tzu-Chieh Hung, Wen-Yuan Lee, Kuen-Bao Chen, and Calvin Yu-Chian Chen Copyright © 2014 Tzu-Chieh Hung et al. All rights reserved. Potential Mitochondrial Isocitrate Dehydrogenase R140Q Mutant Inhibitor from Traditional Chinese Medicine against Cancers Thu, 05 Jun 2014 12:11:34 +0000 A recent research of cancer has indicated that the mutant of isocitrate dehydrogenase 1 and 2 (IDH1 and 2) genes will induce various cancers, including chondrosarcoma, cholangiocarcinomas, and acute myelogenous leukemia due to the effect of point mutations in the active-site arginine residues of isocitrate dehydrogenase (IDH), such as IDH1/R132, IDH2/R140, and IDH2/R172. As the inhibition for those tumor-associated mutant IDH proteins may induce differentiation of those cancer cells, these tumor-associated mutant IDH proteins can be treated as a drug target proteins for a differentiation therapy against cancers. In this study, we aim to identify the potent TCM compounds from the TCM Database@Taiwan as lead compounds of IDH2 R140Q mutant inhibitor. Comparing to the IDH2 R140Q mutant protein inhibitor, AGI-6780, the top two TCM compounds, precatorine and abrine, have higher binding affinities with target protein in docking simulation. After MD simulation, the top two TCM compounds remain as the same docking poses under dynamic conditions. In addition, precatorine is extracted from Abrus precatorius L., which represents the cytotoxic and proapoptotic effects for breast cancer and several tumor lines. Hence, we propose the TCM compounds, precatorine and abrine, as potential candidates as lead compounds for further study in drug development process with the IDH2 R140Q mutant protein against cancer. Wen-Yuan Lee, Kuan-Chung Chen, Hsin-Yi Chen, and Calvin Yu-Chian Chen Copyright © 2014 Wen-Yuan Lee et al. All rights reserved. Treatment of Rheumatoid Arthritis with Traditional Chinese Medicine Wed, 04 Jun 2014 10:01:59 +0000 Rheumatoid arthritis (RA) is a chronic inflammatory disease that will affect quality of life and, working efficiency, and produce negative thoughts for patients. Current therapy of RA is treated with disease-modifying antirheumatic drugs (DMARDs). Although most of these treatment methods are effective, most patients still have a pleasant experience either due to poor efficacy or side effects or both. Interleukin-6 receptor (IL6R) is important in the pathogenesis of RA. In this study, we would like to detect the potential candidates which inhibit IL6R against RA from traditional Chinese medicine (TCM). We use TCM compounds from the TCM Database@Taiwan for virtually screening the potential IL6R inhibitors. The TCM candidate compound, calycosin, has potent binding affinity with IL6R protein. The molecular dynamics simulation was employed to validate the stability of interaction in the protein complex with calycosin. The analysis indicates that protein complex with calycosin is more stable. In addition, calycosin is known to be one of the components of Angelica sinensis, which has been indicated to have an important role in the treatment of rheumatoid arthritis. Therefore, calycosin is a potential candidate as lead compounds for further study in drug development process with IL6R protein against rheumatoid arthritis. Wen-Yuan Lee, Hsin-Yi Chen, Kuan-Chung Chen, and Calvin Yu-Chian Chen Copyright © 2014 Wen-Yuan Lee et al. All rights reserved. An Overview of the Spindle Assembly Checkpoint Status in Oral Cancer Tue, 03 Jun 2014 11:11:38 +0000 Abnormal chromosome number, or aneuploidy, is a common feature of human solid tumors, including oral cancer. Deregulated spindle assembly checkpoint (SAC) is thought as one of the mechanisms that drive aneuploidy. In normal cells, SAC prevents anaphase onset until all chromosomes are correctly aligned at the metaphase plate thereby ensuring genomic stability. Significantly, the activity of this checkpoint is compromised in many cancers. While mutations are rather rare, many tumors show altered expression levels of SAC components. Genomic alterations such as aneuploidy indicate a high risk of oral cancer and cancer-related mortality, and the molecular basis of these alterations is largely unknown. Yet, our knowledge on the status of SAC components in oral cancer remains sparse. In this review, we address the state of our knowledge regarding the SAC defects and the underlying molecular mechanisms in oral cancer, and discuss their therapeutic relevance, focusing our analysis on the core components of SAC and its target Cdc20. José Henrique Teixeira, Patrícia Manuela Silva, Rita Margarida Reis, Inês Moranguinho Moura, Sandra Marques, Joana Fonseca, Luís Silva Monteiro, and Hassan Bousbaa Copyright © 2014 José Henrique Teixeira et al. All rights reserved. p120 Modulates LPS-Induced NF-κB Activation Partially through RhoA in Bronchial Epithelial Cells Tue, 03 Jun 2014 08:14:43 +0000 p120-Catenin (p120) is an adherens junction protein recognized to regulate cell-cell adhesion. Emerging evidence indicates that p120 may also play an important role in inflammatory responses, and the regulatory mechanisms are still unknown. In the present study, we showed that p120 was associated with airway inflammation. p120 downregulation induced nuclear factor-κB (NF-κB) activation, accompanied with IκBα degradation, p65 nuclear translocation, and increased expression of interleukin-8 (IL-8) in lipopolysaccharide (LPS)- treated C57BL mice and human bronchial epithelial cells (BECs). Moreover, we first found that p120 directly coprecipitated with RhoA in BECs. After LPS stimulation, although total RhoA and p120-bound RhoA were unchanged, RhoA activity was increased. Y27632, a ROCK inhibitor, could partially inhibit nuclear translocation of p65. Overexpression of p120 inactivated RhoA and NF-κB in BECs, whereas p120 loss significantly increased RhoA activity, p65 nuclear translocation, and IL-8 expression. Taken together, our study supports the regulatory role of p120 in airway inflammation and reveals that p120 may modulate NF-κB signaling partially through RhoA. Lingzhi Qin, Shenghui Qin, Yanli Zhang, Chao Zhang, Heng Ma, Naping Li, Liwei Liu, Xi Wang, and Renliang Wu Copyright © 2014 Lingzhi Qin et al. All rights reserved. Lead Discovery for Alzheimer’s Disease Related Target Protein RbAp48 from Traditional Chinese Medicine Mon, 02 Jun 2014 07:18:05 +0000 Deficiency or loss of function of Retinoblastoma-associated proteins (RbAp48) is related with Alzheimer’s disease (AD), and AD disease is associated with age-related memory loss. During normal function, RbAp48 forms a complex with the peptide FOG-1 (friend of GATA-1) and has a role in gene transcription, but an unstable complex may affect the function of RbAp48. This study utilizes the world’s largest traditional Chinese medicine (TCM) database and virtual screening to provide potential compounds for RbAp48 binding. A molecular dynamics (MD) simulation was employed to understand the variations after protein-ligand interaction. FOG1 was found to exhibit low stability after RbAp48 binding; the peptide displayed significant movement from the initial docking position, a phenomenon which matched the docking results. The protein structure of the other TCM candidates was not variable during MD simulation and had a greater stable affinity for RbAp48 binding than FOG1. Our results reveal that the protein structure does not affect ligand binding, and the top three TCM candidates Bittersweet alkaloid II, Eicosandioic acid, and Perivine might resolve the instability of the RbAp48-FOG1 complex and thus be used in AD therapy. Hung-Jin Huang, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Hung-Jin Huang et al. All rights reserved. Primary Genetic Investigation of a Hyperlipidemia Model: Molecular Characteristics and Variants of the Apolipoprotein E Gene in Mongolian Gerbil Sun, 01 Jun 2014 00:00:00 +0000 The objective of this work was to establish a novel Mongolian gerbil (Meriones unguiculatus) hyperlipidemia model and to investigate its susceptibility genetic basis. Two rodent (gerbil and rat) hyperlipidemia models were induced by feeding a high fat/high-cholesterol (HF/HC) diet. There were significant increases of serum total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in gerbils within a 4-week modeling period. About 10–30% of >8-month-old individuals developed hyperlipidemia spontaneously. The apolipoprotein E (ApoE) gene was cloned by merging a sequence of rapid amplification of cDNA ends (RACE) and nested polymerase chain reaction products. The results revealed an open reading frame of 948 bp, encoding a protein of 298 amino acids. The gene without a 5′-UTR region in the first intron was highly homologous to human Apo-A-I and rat Apo-A-IV. The distribution of expression of the ApoE gene in liver, brain, heart, lung, kidney, and adrenal gland was detected by an ABC immunohistochemical procedure. Three single nucleotide polymorphisms (SNPs; C97T, G781T, and A1774T) were first found using PCR-single-strand conformation polymorphism (PCR-SSCP) in a closed population containing 444 animals. Correlation analysis confirmed that new SNPs , age, and gender were associated significantly () with hyperlipidemia. Yuehuan Liu, Jiusheng Wu, Qiaojuan Shi, Honggang Guo, Huazhong Ying, and Ningying Xu Copyright © 2014 Yuehuan Liu et al. All rights reserved. The Carbon-Nitrogen Balance of the Nodule and Its Regulation under Elevated Carbon Dioxide Concentration Wed, 28 May 2014 13:09:02 +0000 Legumes have developed a unique way to interact with bacteria: in addition to preventing infection from pathogenic bacteria like any other plant, legumes also developed a mutualistic symbiotic relationship with one gender of soil bacteria: rhizobium. This interaction leads to the development of a new root organ, the nodule, where the differentiated bacteria fix for the plant the atmospheric dinitrogen (atmN2). In exchange, the symbiont will benefit from a permanent source of carbon compounds, products of the photosynthesis. The substantial amounts of fixed carbon dioxide dedicated to the symbiont imposed to the plant a tight regulation of the nodulation process to balance carbon and nitrogen incomes and outcomes. Climate change including the increase of the concentration of the atmospheric carbon dioxide is going to modify the rates of plant photosynthesis, the balance between nitrogen and carbon, and, as a consequence, the regulatory mechanisms of the nodulation process. This review focuses on the regulatory mechanisms controlling carbon/nitrogen balances in the context of legume nodulation and discusses how the change in atmospheric carbon dioxide concentration could affect nodulation efficiency. Marc Libault Copyright © 2014 Marc Libault. All rights reserved. XRCC1 Arg399Gln and Arg194Trp Polymorphisms and Risk of Systemic Lupus Erythematosus in an Iranian Population: A Pilot Study Mon, 26 May 2014 06:39:41 +0000 Background. Evidences are suggesting that DNA damage is implicated in development of systemic lupus erythematosus (SLE). Therefore we focused on two common XRCC1 polymorphisms (Arg399Gln and Arg194Trp) in SLE susceptibility in South East of Iran. Methods. Peripheral blood DNA was extracted from 163 SLE patients and 180 healthy controls. PCR-restriction fragment length polymorphism method was used for genotyping of XRCC1 Arg399Gln and Arg194Trp polymorphisms. Results. The frequency of Arg/Gln genotype of the XRCC1 Arg399Gln polymorphism was significantly lower in SLE patients than controls. Moreover, lower frequency of Arg/Gln genotype was found in SLE patients with malar rash compared to patients without this manifestation. No association was observed between XRCC1 Arg194Trp polymorphism and increased risk of SLE in studied population. Haplotype analysis revealed no correlation between four haplotypes of XRCC1 Arg399Gln and Arg194Trp polymorphisms and SLE risk. Conclusion. These findings suggest that XRCC1 399 Arg/Gln heterozygous genotype plays a protective role in SLE susceptibility. Saeedeh Salimi, Milad Mohammadoo-khorasani, Ehsan Tabatabai, Mahnaz Sandoughi, Zahra Zakeri, and Anoosh Naghavi Copyright © 2014 Saeedeh Salimi et al. All rights reserved. EMMPRIN Expression in Oral Squamous Cell Carcinomas: Correlation with Tumor Proliferation and Patient Survival Wed, 21 May 2014 09:39:21 +0000 The aim of our study was to explore the clinicopathological and prognostic significance of extracellular matrix metalloproteinase inducer (EMMPRIN) expression in oral squamous cell carcinomas (OSCC), and its relation with the proliferative tumor status of OSCC. We examined EMMPRIN and Ki-67 proteins expression by immunohistochemistry in 74 cases with OSCC. Statistical analysis was conducted to examine their clinicopathological and prognostic significance in OSCC. EMMPRIN membrane expression was observed in all cases, with both membrane and cytoplasmic tumor expression in 61 cases (82.4%). EMMPRIN overexpression was observed in 56 cases (75.7%). Moderately or poorly differentiated tumors showed EMMPRIN overexpression more frequently than well-differentiated tumors . Overexpression of EMMPRIN was correlated with high Ki-67 expression . In the multivariate analysis, EMMPRIN overexpression reveals an adverse independent prognostic value for cancer-specific survival (CSS) . Our results reveal that EMMPRIN protein is overexpressed in more than two-thirds of OSCC cases, especially in high proliferative and less differentiated tumors. The independent value of EMMPRIN overexpression in CSS suggests that this protein could be used as an important biological prognostic marker for patients with OSCC. Moreover, the high expression of EMMPRIN makes it a possible therapeutic target in OSCC patients. Luís Silva Monteiro, Maria Leonor Delgado, Sara Ricardo, Fernanda Garcez, Barbas do Amaral, José Júlio Pacheco, Carlos Lopes, and Hassan Bousbaa Copyright © 2014 Luís Silva Monteiro et al. All rights reserved. Computational Design of Apolipoprotein E4 Inhibitors for Alzheimer’s Disease Therapy from Traditional Chinese Medicine Wed, 21 May 2014 06:26:28 +0000 Apolipoprotein E4 (Apo E4) is the major genetic risk factor in the causation of Alzheimer’s disease (AD). In this study we utilize virtual screening of the world’s largest traditional Chinese medicine (TCM) database and investigate potential compounds for the inhibition of ApoE4. We present the top three TCM candidates: Solapalmitine, Isodesacetyluvaricin, and Budmunchiamine L5 for further investigation. Dynamics analysis and molecular dynamics (MD) simulation were used to simulate protein-ligand complexes for observing the interactions and protein variations. Budmunchiamine L5 did not have the highest score from virtual screening; however, the dynamics pose is similar to the initial docking pose after MD simulation. Trajectory analysis reveals that Budmunchiamine L5 was stable over all simulation times. The migration distance of Budmunchiamine L5 illustrates that docked ligands are not variable from the initial docked site. Interestingly, Arg158 was observed to form H-bonds with Budmunchiamine L5 in the docking pose and MD snapshot, which indicates that the TCM compounds could stably bind to ApoE4. Our results show that Budmunchiamine L5 has good absorption, blood brain barrier (BBB) penetration, and less toxicity according to absorption, distribution, metabolism, excretion, and toxicity (ADMET) prediction and could, therefore, be safely used for developing novel ApoE4 inhibitors. Hung-Jin Huang, Hsin-Yi Chen, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Hung-Jin Huang et al. All rights reserved. Chromium (VI) Uptake and Tolerance Potential in Cotton Cultivars: Effect on Their Root Physiology, Ultramorphology, and Oxidative Metabolism Wed, 14 May 2014 09:46:04 +0000 Chromium (Cr) is present in our environment as a toxic pollutant, which needs to be removed using phytoremediation technology. In present study, two transgenic cotton cultivars (J208, Z905) and their hybrid line (ZD14) were used to explore their Cr uptake and tolerance potential using multiple biomarkers approach. Four different levels of Cr (CK, 10, 50, and 100 μM) were applied. Cr caused a significant reduction in root/shoot length, number of secondary roots, and root fresh and dry biomasses at 100 μM. Cr accumulated more in roots and was found higher in hybrid line (ZD14) as compared with its parent lines (J208, Z905) at all Cr stress levels (10, 50, and 100 μM). Cr translocation was less than 1 in all cultivars. Ultrastructural studies at 100 μM Cr showed an increase in number of nuclei and vacuoles and presence of Cr dense granules in dead parts of the cell (vacuoles/cell wall). Malondialdehyde (MDA), hydrogen peroxide (H2O2), total soluble proteins, superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX), catalase (CAT), and glutathione reductase (GR) as a whole were upregulated with elevated levels of Cr. Higher Cr uptake by roots, accelerated metabolism, and Cr sequestration in dead parts of the cell indicate that these cotton cultivars can be useful for Cr accumulation and tolerance. M. K. Daud, Lei Mei, M. T. Variath, Shafaqat Ali, Cheng Li, M. T. Rafiq, and S. J. Zhu Copyright © 2014 M. K. Daud et al. All rights reserved. Solanine Induces Mitochondria-Mediated Apoptosis in Human Pancreatic Cancer Cells Sun, 11 May 2014 09:03:51 +0000 Steroid alkaloids have been suggested as potential anticancer compounds. However, the underlying mechanisms of how steroid alkaloids inhibit the tumor growth are largely unknown. Here, we reported that solanine, a substance of steroid alkaloids, has a positive effect on the inhibition of pancreatic cancer cell growth in vitro and in vivo. In pancreatic cancer cells and nu/nu nude mice model, we found that solanine inhibited cancer cells growth through caspase-3 dependent mitochondrial apoptosis. Mechanically, solanine promotes the opening of mitochondrial membrane permeability transition pore (MPTP) by downregulating the Bcl-2/Bax ratio; thereafter, Cytochrome c and Smac are released from mitochondria into cytosol to process the caspase-3 zymogen into an activated form. Moreover, we found that the expression of tumor metastasis related proteins, MMP-2 and MMP-9, was also decreased in the cells treated with solanine. Therefore, our results suggested that solanine was an effective compound for the treatment of pancreatic cancer. Hongwei Sun, Chongqing Lv, Longlong Yang, Yingxiu Wang, Qingshun Zhang, Suhui Yu, Hongru Kong, Meng Wang, Jianming Xie, Chunwu Zhang, and Mengtao Zhou Copyright © 2014 Hongwei Sun et al. All rights reserved. In Silico Design of BACE1 Inhibitor for Alzheimer’s Disease by Traditional Chinese Medicine Thu, 08 May 2014 07:10:11 +0000 The -site APP cleaving enzyme 1 (BACE1) is an important target for causing Alzheimer’s disease (AD), due to the brain deposition peptide amyloid beta (A) require cleavages of amyloid precursor protein (APP) by BACE1 and -secretase, but treatments of AD still have side effect in recent therapy. This study utilizes the world largest traditional Chinese medicine (TCM) database and database screening to provide potential BACE1 inhibited compound. Molecular dynamics (MD) simulation was carried out to observe the dynamics structure after ligand binding. We found that Triptofordin B1 has less toxicity than pyrimidine analogue, which has more potent binding affinity with BACE1. For trajectory analysis, all conformations are tending to be stable during 5000 ps simulation time. In dynamic protein validation, the residues of binding region are still stable after MD simulation. For snapshot comparison, we found that Triptofordin B1 could reduce the binding cavity; the results reveal that Triptofordin B1 could bind to BACE1 and better than control, which could be used as potential lead drug to design novel BACE1 inhibitor for AD therapy. Hung-Jin Huang, Cheng-Chun Lee, and Calvin Yu-Chian Chen Copyright © 2014 Hung-Jin Huang et al. All rights reserved. Possible Association of IL-4 VNTR Polymorphism with Susceptibility to Preeclampsia Mon, 28 Apr 2014 12:48:52 +0000 Preeclampsia (PE) is a pregnancy-specific disorder that results in maternal mortality and morbidity. Growing evidence indicated that cytokines are involved in the pathogenesis of PE and interleukin-4 VNTR polymorphism could be implicated in altering the PE risk. The aim of this study was to evaluate the possible association between IL-4 VNTR polymorphism and susceptibility to PE in Iranian population for the first time. Genetic polymorphism was evaluated in 192 PE and 186 healthy control women by polymerase chain reaction method. We found that the VNTR polymorphism of IL-4 gene has significantly increased the risk of preeclampsia (RP2/RP1 versus RP1/RP1, OR, 2.8 [95% CI, 1.7 to 8.8]; and RP2/RP2 versus RP1/RP1; ). The results showed that carriage of IL-4 VNTR RP2 allele has positive association with preeclampsia susceptibility. Saeedeh Salimi, Milad Mohammadoo-Khorasani, Minoo Yaghmaei, Mojgan Mokhtari, and Maryam Moossavi Copyright © 2014 Saeedeh Salimi et al. All rights reserved. Current Advances in Molecular Phylogenetics Mon, 07 Apr 2014 09:37:53 +0000 Vassily Lyubetsky, William H. Piel, and Dietmar Quandt Copyright © 2014 Vassily Lyubetsky et al. All rights reserved. Phylogenetic Analysis of Entomoparasitic Nematodes, Potential Control Agents of Flea Populations in Natural Foci of Plague Thu, 03 Apr 2014 10:58:16 +0000 Entomoparasitic nematodes are natural control agents for many insect pests, including fleas that transmit Yersinia pestis, a causative agent of plague, in the natural foci of this extremely dangerous zoonosis. We examined the flea samples from the Volga-Ural natural focus of plague for their infestation with nematodes. Among the six flea species feeding on different rodent hosts (Citellus pygmaeus, Microtus socialis, and Allactaga major), the rate of infestation varied from 0 to 21%. The propagation rate of parasitic nematodes in the haemocoel of infected fleas was very high; in some cases, we observed up to 1,000 juveniles per flea specimen. Our study of morphology, life cycle, and rDNA sequences of these parasites revealed that they belong to three distinct species differing in the host specificity. On SSU and LSU rRNA phylogenies, these species representing three genera (Rubzovinema, Psyllotylenchus, and Spilotylenchus), constitute a monophyletic group close to Allantonema and Parasitylenchus, the type genera of the families Allantonematidae and Parasitylenchidae (Nematoda: Tylenchida). We discuss the SSU-ITS1-5.8S-LSU rDNA phylogeny of the Tylenchida with a special emphasis on the suborder Hexatylina. E. I. Koshel, V. V. Aleshin, G. A. Eroshenko, and V. V. Kutyrev Copyright © 2014 E. I. Koshel et al. All rights reserved. A New Nested Allele-Specific Multiplex Polymerase Chain Reaction Method for Haplotyping of VKORC1 Gene to Predict Warfarin Sensitivity Sun, 30 Mar 2014 12:16:06 +0000 The vitamin K epoxide reductase complex 1 gene (VKORC1) is commonly assessed to predict warfarin sensitivity. In this study, a new nested allele-specific multiplex polymerase chain reaction (PCR) method that can simultaneously identify single nucleotide polymorphisms (SNPs) at VKORC1 381, 861, 5808, and 9041 for haplotype analysis was developed and validated. Extracted DNA was amplified in the first PCR DNA, which was optimized by investigating the effects of varying the primer concentrations, annealing temperature, magnesium chloride concentration, enzyme concentration, and the amount of DNA template. The amplification products produced from the first round of PCR were used as templates for a second PCR amplification in which both mutant and wild-type primers were added in separate PCR tubes, followed by optimization in a similar manner. The final PCR products were resolved by agarose gel electrophoresis and further analysed by using a VKORC1 genealogic tree to infer patient haplotypes. Fifty patients were identified to have H1H1, one had H1H2, one had H1H7, 31 had either H1H7 or H1H9, one had H1H9, eight had H7H7, and one had H8H9 haplotypes. This is the first method that is able to infer VKORC1 haplotypes using only conventional PCR methods. Yung An Chua, Wan Zaidah Abdullah, Zukurnai Yusof, and Siew Hua Gan Copyright © 2014 Yung An Chua et al. All rights reserved. Reconciliation of Gene and Species Trees Thu, 27 Mar 2014 06:44:11 +0000 The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i) inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii) trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii) can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree. L. Y. Rusin, E. V. Lyubetskaya, K. Y. Gorbunov, and V. A. Lyubetsky Copyright © 2014 L. Y. Rusin et al. All rights reserved. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms Wed, 05 Mar 2014 00:00:00 +0000 A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. Zhiyuan Wu, Yunqing Zhang, Xinju Zhang, Xiao Xu, Zhihua Kang, Shibao Li, Chen Zhang, Bing Su, and Ming Guan Copyright © 2014 Zhiyuan Wu et al. All rights reserved. Noncoding RNAs: Emerging Players in Muscular Dystrophies Tue, 04 Mar 2014 09:46:56 +0000 The fascinating world of noncoding RNAs has recently come to light, thanks to the development of powerful sequencing technologies, revealing a variety of RNA molecules playing important regulatory functions in most, if not all, cellular processes. Many noncoding RNAs have been implicated in regulatory networks that are determinant for skeletal muscle differentiation and disease. In this review, we outline the noncoding RNAs involved in physiological mechanisms of myogenesis and those that appear dysregulated in muscle dystrophies, also discussing their potential use as disease biomarkers and therapeutic targets. Germana Falcone, Alessandra Perfetti, Beatrice Cardinali, and Fabio Martelli Copyright © 2014 Germana Falcone et al. All rights reserved. Sex Differences in Constitutive Autophagy Thu, 27 Feb 2014 15:58:50 +0000 Sex bias has been described nowadays in biomedical research on animal models, although sexual dimorphism has been confirmed widely under pathological and physiological conditions. The main objective of our work was to study the sex differences in constitutive autophagy in spinal cord and skeletal muscle tissue from wild type mice. To examine the influence of sex on autophagy, mRNA and proteins were extracted from male and female mice tissues. The expressions of microtubule-associated protein 1 light chain 3 (LC3) and sequestosome 1 (p62), markers to monitor autophagy, were analyzed at 40, 60, 90, and 120 days of age. We found significant sex differences in the expression of LC3 and p62 in both tissues at these ages. The results indicated that sex and tissue specific differences exist in constitutive autophagy. These data underlined the need to include both sexes in the experimental groups to minimize any sex bias. Sara Oliván, Ana Cristina Calvo, Raquel Manzano, Pilar Zaragoza, and Rosario Osta Copyright © 2014 Sara Oliván et al. All rights reserved. Role of Noncoding RNAs in the Regulation of P-TEFb Availability and Enzymatic Activity Wed, 19 Feb 2014 10:09:00 +0000 P-TEFb is a transcriptional factor that specifically regulates the elongation step of RNA polymerase II-dependent transcription and its activity strictly required for Human Immunodeficiency Virus (HIV) infection and during cardiac differentiation. P-TEFb role has emerged as a crucial regulator of transcription elongation and its activity found finely tuned in vivo at transcriptional level as well as posttranscriptionally by dynamic association with different multisubunit molecular particles. Both physiological and pathological cellular signals rapidly converge on P-TEFb regulation by modifying expression and activity of the complex to allow cells to properly respond to different stimuli. In this review we will give a panoramic view on P-TEFb regulation by noncoding RNAs in both physiological and pathological conditions. Giuliana Napolitano, Luigi Lania, and Barbara Majello Copyright © 2014 Giuliana Napolitano et al. All rights reserved. Insulin Receptor Substrate-1 (IRS-1) Gly927Arg: Correlation with Gestational Diabetes Mellitus in Saudi Women Mon, 17 Feb 2014 12:24:40 +0000 Pregnant women with gestational diabetes mellitus (GDM) and type 2 diabetes mellitus (T2DM) share a common pathophysiology associated with similar risk factors. Genetic variants used to determine the risk of developing T2DM might also be associated with the prevalence of GDM. The aim of the present study was to scrutinize the relationship between the G972R polymorphism of the insulin receptor substrate-1 (IRS-1) gene with GDM in the Saudi female population. This is a case-control study that monitored 500 Saudi women. Subjects with GDM () were compared with non-GDM () controls. We opted to evaluate rs1801278 polymorphism in the IRS1 gene, which plays a critical role in the insulin-signaling pathway. Genotyping was performed with the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method. The frequency of the rs1801278 polymorphism was significantly higher in women with GDM than in women with non-GDM (for TT + CT versus CC: ). Additionally, there was a significant increase in the frequency of the Arg-encoding mutant allele from GDM to non-GDM (for T versus C: ). Our results suggest that the rs1801278 polymorphism in the IRS-1 gene is involved in the occurrence of GDM in the Saudi population. Khalid Khalaf Alharbi, Imran Ali Khan, Zeinab Abotalib, and Malak Mohammed Al-Hakeem Copyright © 2014 Khalid Khalaf Alharbi et al. All rights reserved. The Role of PinX1 in Growth Control of Breast Cancer Cells and Its Potential Molecular Mechanism by mRNA and lncRNA Expression Profiles Screening Mon, 03 Feb 2014 11:13:11 +0000 As a major tumor suppressor gene, the role of PinX1 in breast cancer and its molecular mechanism remain unclear. In this study, overexpression of PinX1 was generated in 3 breast cancer cell lines, and knockdown of PinX1 was performed in a nontumorigenic breast cell line. The regulation of PinX1 on cell proliferation and cell cycle was observed. A microarray-based lncRNA and mRNA expression profile screening was also performed. We found a lower growth rate, G0/G1 phase arrest, and S phase inhibition in the PinX1 overexpressed breast cancer cells, while a higher growth rate, decreased G0/G1 phase, and increased S phase rate in the PinX1 knocked-down nontumorigenic breast cell. A total of 977 mRNAs and 631 lncRNAs were identified as differentially expressed transcripts between PinX1 overexpressed and control MCF-7 cells. Further analysis identified the involvement of these mRNAs in 52 cancer related pathways and various other biological processes. 11 enhancer-like lncRNAs and 25 lincRNAs with their adjacent mRNA pairs were identified as coregulated transcripts. Our results confirmed the role of PinX1 as a major tumor suppressor gene in breast cancer cell lines and provided information for further research on the molecular mechanisms of PinX1 in tumorigenesis. Rong Shi, Jue-Yu Zhou, Hui Zhou, Zhen Zhao, Sang-Hua Liang, Wen-Ling Zheng, and Wen-Li Ma Copyright © 2014 Rong Shi et al. All rights reserved. Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species Wed, 29 Jan 2014 00:00:00 +0000 The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. Oksana S. Bychenko, Lyubov V. Sukhanova, Tatyana L. Azhikina, Timofey A. Skvortsov, Tuyana V. Belomestnykh, and Eugene D. Sverdlov Copyright © 2014 Oksana S. Bychenko et al. All rights reserved. Brd4 and HEXIM1: Multiple Roles in P-TEFb Regulation and Cancer Wed, 29 Jan 2014 00:00:00 +0000 Bromodomain-containing protein 4 (Brd4) and hexamethylene bisacetamide (HMBA) inducible protein 1 (HEXIM1) are two opposing regulators of the positive transcription elongation factor b (P-TEFb), which is the master modulator of RNA polymerase II during transcriptional elongation. While Brd4 recruits P-TEFb to promoter-proximal chromatins to activate transcription, HEXIM1 sequesters P-TEFb into an inactive complex containing the 7SK small nuclear RNA. Besides regulating P-TEFb’s transcriptional activity, recent evidence demonstrates that both Brd4 and HEXIM1 also play novel roles in cell cycle progression and tumorigenesis. Here we will discuss the current knowledge on Brd4 and HEXIM1 and their implication as novel therapeutic options against cancer. Ruichuan Chen, Jasper H. N. Yik, Qiao Jing Lew, and Sheng-Hao Chao Copyright © 2014 Ruichuan Chen et al. All rights reserved. Molecular Characterization of a Recombinant Manganese Superoxide Dismutase from Lactococcus lactis M4 Mon, 27 Jan 2014 12:38:58 +0000 A superoxide dismutase (SOD) gene of Lactococcus lactis M4 was cloned and expressed in a prokaryotic system. Sequence analysis revealed an open reading frame of 621 bp which codes for 206 amino acid residues. Expression of sodA under T7 promoter exhibited a specific activity of 4967 U/mg when induced with 1 mM of isopropyl-β-D-thiogalactopyranoside. The recombinant SOD was purified to homogeneity by immobilised metal affinity chromatography and Superose 12 gel filtration chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot analyses of the recombinant SOD detected a molecular mass of approximately 27 kDa. However, the SOD was in dimer form as revealed by gel filtration chromatography. The purified recombinant enzyme had a pI of 4.5 and exhibited maximal activity at 25°C and pH 7.2. It was stable up to 45°C. The insensitivity of this lactococcal SOD to cyanide and hydrogen peroxide established that it was a MnSOD. Although it has 98% homology to SOD of L. lactis IL1403, this is the first elucidated structure of lactococcal SOD revealing active sites containing the catalytic manganese coordinated by four ligands (H-27, H-82, D-168, and H-172). Boon Hooi Tan, Thean Chor Leow, Hooi Ling Foo, and Raha Abdul Rahim Copyright © 2014 Boon Hooi Tan et al. All rights reserved. DNA Methylation Pattern in Overweight Women under an Energy-Restricted Diet Supplemented with Fish Oil Wed, 22 Jan 2014 12:50:44 +0000 Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC). However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA) on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded. Cátia Lira do Amaral, Fermín I. Milagro, Rui Curi, and J. Alfredo Martínez Copyright © 2014 Cátia Lira do Amaral et al. All rights reserved. Erratum to “Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization” Mon, 20 Jan 2014 00:00:00 +0000 Saliou Niassy, Sevgan Subramanian, Sunday Ekesi, Joel L. Bargul, Jandouwe Villinger, and Nguya K. Maniania Copyright © 2014 Saliou Niassy et al. All rights reserved. Changes in Bacterial Population of Gastrointestinal Tract of Weaned Pigs Fed with Different Additives Sun, 19 Jan 2014 08:12:32 +0000 This study aimed to provide novel insights into the gastrointestinal microbial diversity from different gastrointestinal locations in weaning piglets using PCR-restriction fragment length polymorphism (PCR-RFLP). Additionally, the effect of different feed additives was analyzed. Thirty-two piglets were fed with four different diets: a control group and three enriched diets, with avilamycin, sodium butyrate, and a plant extract mixture. Digesta samples were collected from eight different gastrointestinal segments of each animal and the bacterial population was analysed by a PCR-RFLP technique that uses 16S rDNA gene sequences. Bacterial diversity was assessed by calculating the number of bands and the Shannon-Weaver index. Dendrograms were constructed to estimate the similarity of bacterial populations. A higher bacterial diversity was detected in large intestine compared to small intestine. Among diets, the most relevant microbial diversity differences were found between sodium butyrate and plant extract mixture. Proximal jejunum, ileum, and proximal colon were identified as those segments that could be representative of microbial diversity in pig gut. Results indicate that PCR-RFLP technique allowed detecting modifications on the gastrointestinal microbial ecology in pigs fed with different additives, such as increased biodiversity by sodium butyrate in feed. Mercè Roca, Miquel Nofrarías, Natàlia Majó, Ana María Pérez de Rozas, Joaquim Segalés, Marisol Castillo, Susana María Martín-Orúe, Anna Espinal, Joan Pujols, and Ignacio Badiola Copyright © 2014 Mercè Roca et al. All rights reserved. Regulation of CDK9 Activity by Phosphorylation and Dephosphorylation Sun, 12 Jan 2014 14:00:54 +0000 HIV-1 transcription is regulated by CDK9/cyclin T1, which, unlike a typical cell cycle-dependent kinase, is regulated by associating with 7SK small nuclear ribonuclear protein complex (snRNP). While the protein components of this complex are well studied, the mechanism of the complex formation is still not fully understood. The association of CDK9/cyclin T1 with 7SK snRNP is, in part, regulated by a reversible CDK9 phosphorylation. Here, we present a comprehensive review of the kinases and phosphatases involved in CDK9 phosphorylation and discuss their role in regulation of HIV-1 replication and potential for being targeted for drug development. We propose a novel pathway of HIV-1 transcription regulation via CDK9 Ser-90 phosphorylation by CDK2 and CDK9 Ser-175 dephosphorylation by protein phosphatase-1. Sergei Nekhai, Michael Petukhov, and Denitra Breuer Copyright © 2014 Sergei Nekhai et al. All rights reserved. Isolation and Expression Analysis of Novel Silicon Absorption Gene from Roots of Mangrove (Rhizophora apiculata) via Suppression Subtractive Hybridization Wed, 01 Jan 2014 21:41:53 +0000 Silicon (Si) is the second most abundant element in soil after oxygen. It is not an essential element for plant growth and formation but plays an important role in increasing plant tolerance towards different kinds of abiotic and biotic stresses. The molecular mechanism of Si absorption and accumulation may differ between plants, such as monocotyledons and dicotyledons. Silicon absorption and accumulation in mangrove plants are affected indirectly by some proteins rich in serine and proline amino acids. The expression level of the genes responsible for Si absorption varies in different parts of plants. In this study, Si is mainly observed in the epidermal roots’ cell walls of mangrove plants compared to other parts. The present work was carried out to discover further information on Si stress responsive genes in Rhizophora apiculata, using the suppression subtractive hybridization technique. To construct the cDNA library, two-month-old seedlings were exposed to 0.5, 1, and 1.5 mM SiO2 for 15 hrs and for 1 to 6 days resulting in a total of 360 high quality ESTs gained. Further examination by RT-PCR and real-time qRT-PCR showed the expression of a candidate gene of serine-rich protein. Mahbod Sahebi, Mohamed M. Hanafi, Siti Nor Akmar Abdullah, Mohd Y. Rafii, Parisa Azizi, Naghmeh Nejat, and Abu Seman Idris Copyright © 2014 Mahbod Sahebi et al. All rights reserved. Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta): A New Species from South China Sea Based on Morphological Observation and rbcL Gene Sequences Analysis Mon, 23 Dec 2013 13:36:53 +0000 Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1) thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2) cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3) the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81–108 bp from the sequences of other samples in Grateloupia; there are 114–133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia. Ling Yu, Hongwei Wang, and Rixiao Luan Copyright © 2013 Ling Yu et al. All rights reserved. Overexpression of RKIP Inhibits Cell Invasion in Glioma Cell Lines through Upregulation of miR-98 Thu, 12 Dec 2013 13:40:04 +0000 Raf-1 kinase inhibitor protein (RKIP) is a tumor and metastasis suppressor in cancer cells. MicroRNAs (miRNAs) have been suggested to play a vital role in tumor initiation and progression by negatively regulating oncogenes and tumor suppressors. Quite recently, studies have identified some miRNAs operating to promote or suppress tumor invasion or metastasis via regulating metastasis-related genes, providing potential therapeutic targets on antimetastasis strategy. In this study, we found that the expression of RKIP and miR-98 in glioma tissues were significantly lower than that in normal brain tissues. Overexpression of RKIP upregulated miR-98 expression and inhibited glioma cell invasion and miR-98 target gene HMGA2 but had no effect in glioma cell proliferation. Moreover, forced expression of miR-98 accelerated the inhibition of glioma cell invasion and the expression of HMGA2 also had no effect in glioma cell proliferation. Our findings newly described RKIP/miR-98 to HMGA2 link and provided a potential mechanism for glioma cell invasion. RKIP and miR-98 may illustrate the potential therapeutic utility of signaling pathway signatures. Zigui Chen, Quan Cheng, Zhiming Ma, Haipeng Xi, Renjun Peng, and Bing Jiang Copyright © 2013 Zigui Chen et al. All rights reserved. Algorithms of Ancestral Gene Length Reconstruction Tue, 26 Nov 2013 14:59:15 +0000 Ancestral sequence reconstruction is a well-known problem in molecular evolution. The problem presented in this study is inspired by sequence reconstruction, but instead of leaf-associated sequences we consider only their lengths. We call this problem ancestral gene length reconstruction. It is a problem of finding an optimal labeling which minimizes the total length’s sum of the edges, where both a tree and nonnegative integers associated with corresponding leaves of the tree are the input. In this paper we give a linear algorithm to solve the problem on binary trees for the Manhattan cost function . Alexander Bolshoy and Valery M. Kirzhner Copyright © 2013 Alexander Bolshoy and Valery M. Kirzhner. All rights reserved. The Continuing Debate on Deep Molluscan Phylogeny: Evidence for Serialia (Mollusca, Monoplacophora + Polyplacophora) Thu, 21 Nov 2013 17:46:14 +0000 Molluscs are a diverse animal phylum with a formidable fossil record. Although there is little doubt about the monophyly of the eight extant classes, relationships between these groups are controversial. We analysed a comprehensive multilocus molecular data set for molluscs, the first to include multiple species from all classes, including five monoplacophorans in both extant families. Our analyses of five markers resolve two major clades: the first includes gastropods and bivalves sister to Serialia (monoplacophorans and chitons), and the second comprises scaphopods sister to aplacophorans and cephalopods. Traditional groupings such as Testaria, Aculifera, and Conchifera are rejected by our data with significant Approximately Unbiased (AU) test values. A new molecular clock indicates that molluscs had a terminal Precambrian origin with rapid divergence of all eight extant classes in the Cambrian. The recovery of Serialia as a derived, Late Cambrian clade is potentially in line with the stratigraphic chronology of morphologically heterogeneous early mollusc fossils. Serialia is in conflict with traditional molluscan classifications and recent phylogenomic data. Yet our hypothesis, as others from molecular data, implies frequent molluscan shell and body transformations by heterochronic shifts in development and multiple convergent adaptations, leading to the variable shells and body plans in extant lineages. I. Stöger, J. D. Sigwart, Y. Kano, T. Knebelsberger, B. A. Marshall, E. Schwabe, and M. Schrödl Copyright © 2013 I. Stöger et al. All rights reserved. Speciation in Thaparocleidus (Monogenea: Dactylogyridae) Parasitizing Asian Pangasiid Catfishes Wed, 20 Nov 2013 08:52:05 +0000 The phylogeny of monogeneans of the genus Thaparocleidus that parasitize the gills of Pangasiidae in Borneo and Sumatra was inferred from molecular data to investigate parasite speciation. The phylogeny of the Pangasiidae was also reconstructed in order to investigate host-parasite coevolutionary history. The monophyly of Thaparocleidus parasitizing Pangasiidae was confirmed. Low intraspecies molecular variability was observed in three Thaparocleidus species collected from geographically distant localities. However, a high intraspecies molecular variability was observed in two Thaparocleidus species suggesting that these species represent a complex of species highly similar in morphology. Distance-based and tree-based methods revealed a significant global fit between parasite and host phylogenies. Parasite duplication (i.e., intrahost speciation) was recognized as the most common event in Thaparocleidus, while the numbers of cospeciation and host switches were lower and similar to each other. When collapsing nodes correspond to duplication cases, our results suggest host switches in the Thaparocleidus-Pangasiidae system precluding congruence between host and parasite trees. We found that the morphometric variability of the parasite attachment organ is not linked to phylogeny, suggesting that the attachment organ is under adaptive constraint. We showed that haptor morphometry is linked to host specificity, whereby nonspecific parasites display higher morphometric variability than specialists. Andrea Šimková, Celine Serbielle, Antoine Pariselle, Maarten P. M. Vanhove, and Serge Morand Copyright © 2013 Andrea Šimková et al. All rights reserved. The Evolutionary Pattern and the Regulation of Stearoyl-CoA Desaturase Genes Thu, 07 Nov 2013 17:33:37 +0000 Stearoyl-CoA desaturase (SCD) is a key enzyme that converts saturated fatty acids (SFAs) to monounsaturated fatty acids (MUFAs) in the biosynthesis of fat. To date, two isoforms of scd gene (scd1 and scd5) have been found widely existent in most of the vertebrate animals. However, the evolutionary patterns of both isofoms and the function of scd5 are poorly understandable. Herein, we aim to characterize the evolutionary pattern of scd genes and further predict the function differentiation of scd genes. The sequences of scd genes were highly conserved among eukaryote. Phylogenetic analysis identified two duplications of scd gene early in vertebrate evolution. The relative rate ratio test, branch-specific dN/dS ratio tests, and branch-site dN/dS ratio tests all suggested that the scd genes were evolved at a similar rate. The evolution of scd genes among eukaryote was under strictly purifying selection though several sites in scd1 and scd5 were undergone a relaxed selection pressure. The variable binding sites by transcriptional factors at the 5′-UTR and by miRNAs at 3′-UTR of scd genes suggested that the regulators of scd5 may be different from that of scd1. This study promotes our understanding of the evolutionary patterns and function of SCD genes in eukaryote. Xiaoyun Wu, Xiaoju Zou, Qing Chang, Yuru Zhang, Yunhai Li, Linqiang Zhang, Jingfei Huang, and Bin Liang Copyright © 2013 Xiaoyun Wu et al. All rights reserved. Study on Characteristics of Chemokine CXCL10 Gene Cloned from cDNA Expression Library of Ujumqin Sheep Sat, 28 Sep 2013 12:18:35 +0000 Chemokines were a major regulator of body’s inflammatory and immune responses. In this study, the cDNA fragment of chemokine CXC ligand 10 (CXCL10) was cloned from the Ujumqin sheep ear marginal tissue cDNA expression library; the CXCL10 gene had 103 amino acids and a molecular weight of 11.47 kDa, and it shared a high homology among cattle, sheep, and goat, while a low homology compared with mouse. The CXCL10 protein had 4 conservative cysteine residues, located in 28, 30, 55, and 72 sites. The expression pattern and intracellular distribution of recombinant CXCL10 proteins in Ujumqin sheep fibroblast cells showed that there were green fluorescence signals both in cytoplasm and nucleolus after 24 h of transfection, the number of positive cells was increased with time, the peak level of fluorescence signal was reached after 48 h of transfection and the transfection efficiency was 33.3%; there was a significant decrease in fluorescence intensity after 72 h of transfection. Expression of recombinant CXCL10 gene in Escherichia coli had a time- and temperature-dependency on the amount of protein expression, and a small quantity of inducer was needed. P. F. Hu, X. C. Li, N. Lei, X. Y. Lan, Q. J. Zhao, W. J. Guan, and Y. H. Ma Copyright © 2013 P. F. Hu et al. All rights reserved. Adaptation or Malignant Transformation: The Two Faces of Epigenetically Mediated Response to Stress Thu, 26 Sep 2013 09:00:25 +0000 Adaptive response to stress is a fundamental property of living systems. At the cellular level, many different types of stress elicit an essentially limited repertoire of adaptive responses. Epigenetic changes are the main mechanism for medium- to long-term adaptation to accumulated (intense, long-term, or repeated) stress. We propose the adaptive deregulation of the epigenome in response to stress (ADERS) hypothesis which assumes that the unspecific adaptive stress response grows stronger with the increasing stress level, epigenetically activating response gene clusters while progressively deregulating other cellular processes. The balance between the unspecific adaptive response and the general epigenetic deregulation is critical because a strong response can lead to pathology, particularly to malignant transformation. The main idea of our hypothesis is the continuum traversed by a cell subjected to accumulated stress, which lies between an unspecific adaptive response and pathological deregulation—the two extremes sharing the same underlying cause, which is a manifestation of a unified epigenetically mediated adaptive response to stress. The evolutionary potential of epigenetic regulation in multigenerational adaptation is speculatively discussed in the light of neo-Lamarckism. Finally, an approach to testing the proposed hypothesis is presented, relying on either the publicly available datasets or on conducting new experiments. Aleksandar Vojta and Vlatka Zoldoš Copyright © 2013 Aleksandar Vojta and Vlatka Zoldoš. All rights reserved. Molecular and Immunogenic Properties of Apyrase SP01B and D7-Related SP04 Recombinant Salivary Proteins of Phlebotomus perniciosus from Madrid, Spain Sun, 22 Sep 2013 14:08:56 +0000 Sand fly salivary proteins are on the spotlight to become vaccine candidates against leishmaniasis and to markers of exposure to sand fly bites due to the host immune responses they elicit. Working with the whole salivary homogenate entails serious drawbacks such as the need for maintaining sand fly colonies and the laborious task of glands dissection. In order to overcome these difficulties, producing recombinant proteins of different vectors has become a major task. In this study, a cDNA library was constructed with the salivary glands of Phlebotomus perniciosus from Madrid, Spain, the most widespread vector of Leishmania infantum in the Mediterranean basin. Analysis of the cDNA sequences showed several polymorphisms among the previously described salivary transcripts. The apyrase SP01B and the D7-related protein SP04 were successfully cloned, expressed in Escherichia coli, and purified. Besides, recombinant proteins were recognized by sera of hamsters and mice previously immunized with saliva through the exposure to uninfected sand fly bites. These results suggest that these two recombinant proteins conserved their immunogenic properties after expression in a prokaryote system. Therefore, this work contributes to expand the knowledge of P. perniciosus saliva that would be eventually used for the development of tools for vector control programs. Inés Martín-Martín, Ricardo Molina, and Maribel Jiménez Copyright © 2013 Inés Martín-Martín et al. All rights reserved. In-Vivo Effect of Andrographolide on Alveolar Bone Resorption Induced by Porphyromonas gingivalis and Its Relation with Antioxidant Enzymes Tue, 17 Sep 2013 09:20:14 +0000 Alveolar bone resorption is one of the most important facts in denture construction. Porphyromonas gingivalis (Pg) causes alveolar bone resorption, and morphologic measurements are the most frequent methods to identify bone resorption in periodontal studies. This study has aimed at evaluating the effect of Andrographolide (AND) on alveolar bone resorption in rats induced by Pg. 24 healthy male Sprague Dawley rats were divided into four groups as follows: normal control group and three experimental groups challenged orally with Pg ATCC 33277 five times a week supplemented with 20 mg/kg and 10 mg/kg of AND for twelve weeks. Alveolar bones of the left and right sides of the mandible were assessed by a morphometric method. The bone level, that is, the distance from the alveolar bone crest to cementumenamel junction (CEJ), was measured using 6.1 : 1 zoom stereomicroscope and software. AND reduced the effect of Pg on alveolar bone resorption and decreased the serum levels of Hexanoyl-Lysine (HEL); furthermore the reduced glutathione/oxidised glutathione (GSH/GSSG) ratio in AND treated groups (10 and 20 mg/kg) significantly increased when compared with the Pg group . We can conclude that AND suppresses alveolar bone resorption caused by Pg in rats. Rami Al Batran, Fouad H. Al-Bayaty, and Mazen M. Jamil Al-Obaidi Copyright © 2013 Rami Al Batran et al. All rights reserved. Recombinant Rat CC10 Protein Inhibits PDGF-Induced Airway Smooth Muscle Cells Proliferation and Migration Wed, 11 Sep 2013 15:05:14 +0000 Abnormal migration and proliferation of airway smooth muscle cells (ASMCs) in the airway cause airway wall thickening, which is strongly related with the development of airway remodeling in asthma. Clara cell 10 kDa protein (CC10), which is secreted by the epithelial clara cells of the pulmonary airways, plays an important role in the regulation of immunological and inflammatory processes. Previous studies suggested that CC10 protein had great protective effects against inflammation in asthma. However, the effects of CC10 protein on ASMCs migration and proliferation in airway remodeling were poorly understood. In this study, we constructed the pET-22b-CC10 recombinant plasmid, induced expression and purified the recombinant rat CC10 protein from E. coli by Ni2+ affinity chromatography and ion exchange chromatography purification. We investigated the effect of recombinant rat CC10 protein on platelet-derived growth factor (PDGF)-BB-induced ASMCs proliferation and migration. Our results demonstrated that the recombinant CC10 protein could inhibit PDGF-BB-induced cell viability, proliferation and migration. Western blot analysis showed that PDGF-BB-induced activation of cyclin D1 was inhibited by CC10. These findings implicated that CC10 could inhibit increased ASMCs proliferation, and migration induced by PDGF-BB, and this suppression effect might be associated with inhibition of cyclin D1 expression, which might offer hope for the future treatment of airway remodeling. Ying Wei, Yu-Dong Xu, Lei-Miao Yin, Yu Wang, Jun Ran, Qi Liu, Zi-Feng Ma, Yan-Yan Liu, and Yong-Qing Yang Copyright © 2013 Ying Wei et al. All rights reserved. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae) Inferred from Multiple Nuclear Gene Sequences Tue, 10 Sep 2013 08:46:35 +0000 Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae) have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1), recombination activating gene 2 (rag2), and early growth response 1 gene (egr1), from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia. Keun-Yong Kim, Myeong-Hun Ko, Huanzhang Liu, Qiongying Tang, Xianglin Chen, Jun-Ichi Miyazaki, and In-Chul Bang Copyright © 2013 Keun-Yong Kim et al. All rights reserved. Evolutionary Relations of Hexanchiformes Deep-Sea Sharks Elucidated by Whole Mitochondrial Genome Sequences Thu, 05 Sep 2013 17:40:14 +0000 Hexanchiformes is regarded as a monophyletic taxon, but the morphological and genetic relationships between the five extant species within the order are still uncertain. In this study, we determined the whole mitochondrial DNA (mtDNA) sequences of seven sharks including representatives of the five Hexanchiformes, one squaliform, and one carcharhiniform and inferred the phylogenetic relationships among those species and 12 other Chondrichthyes (cartilaginous fishes) species for which the complete mitogenome is available. The monophyly of Hexanchiformes and its close relation with all other Squaliformes sharks were strongly supported by likelihood and Bayesian phylogenetic analysis of 13,749 aligned nucleotides of 13 protein coding genes and two rRNA genes that were derived from the whole mDNA sequences of the 19 species. The phylogeny suggested that Hexanchiformes is in the superorder Squalomorphi, Chlamydoselachus anguineus (frilled shark) is the sister species to all other Hexanchiformes, and the relations within Hexanchiformes are well resolved as Chlamydoselachus, (Notorynchus, (Heptranchias, (Hexanchus griseus, H. nakamurai))). Based on our phylogeny, we discussed evolutionary scenarios of the jaw suspension mechanism and gill slit numbers that are significant features in the sharks. Keiko Tanaka, Takashi Shiina, Taketeru Tomita, Shingo Suzuki, Kazuyoshi Hosomichi, Kazumi Sano, Hiroyuki Doi, Azumi Kono, Tomoyoshi Komiyama, Hidetoshi Inoko, Jerzy K. Kulski, and Sho Tanaka Copyright © 2013 Keiko Tanaka et al. All rights reserved. Dynamic of Mutational Events in Variable Number Tandem Repeats of Escherichia coli O157:H7 Thu, 05 Sep 2013 08:37:38 +0000 VNTRs regions have been successfully used for bacterial subtyping; however, the hypervariability in VNTR loci is problematic when trying to predict the relationships among isolates. Since few studies have examined the mutation rate of these markers, our aim was to estimate mutation rates of VNTRs specific for verotoxigenic E. coli O157:H7. The knowledge of VNTR mutational rates and the factors affecting them would make MLVA more effective for epidemiological or microbial forensic investigations. For this purpose, we analyzed nine loci performing parallel, serial passage experiments (PSPEs) on 9 O157:H7 strains. The combined 9 PSPE population rates for the 8 mutating loci ranged from 4.4 × 10−05 to 1.8 × 10−03 mutations/generation, and the combined 8-loci mutation rate was of 2.5 × 10−03 mutations/generation. Mutations involved complete repeat units, with only one point mutation detected. A similar proportion between single and multiple repeat changes was detected. Of the 56 repeat mutations, 59% were insertions and 41% were deletions, and 72% of the mutation events corresponded to O157-10 locus. For alleles with up to 13 UR, a constant and low mutation rate was observed; meanwhile longer alleles were associated with higher and variable mutation rates. Our results are useful to interpret data from microevolution and population epidemiology studies and particularly point out that the inclusion or not of O157-10 locus or, alternatively, a differential weighting data according to the mutation rates of loci must be evaluated in relation with the objectives of the proposed study. A. V. Bustamante, A. M. Sanso, D. O. Segura, A. E. Parma, and P. M. A. Lucchesi Copyright © 2013 A. V. Bustamante et al. All rights reserved. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas Tue, 03 Sep 2013 11:36:33 +0000 The epithelial membrane protein 3 (EMP3) is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors. Marta Mellai, Angela Piazzi, Valentina Caldera, Laura Annovazzi, Oriana Monzeglio, Rebecca Senetta, Paola Cassoni, and Davide Schiffer Copyright © 2013 Marta Mellai et al. All rights reserved. Common Variant of FTO Gene, rs9939609, and Obesity in Pakistani Females Mon, 02 Sep 2013 14:48:02 +0000 Numerous studies confirmed the association of FTO (fat mass and obesity associated gene) common variant, rs9939609, with obesity in European populations. However, studies in Asian populations revealed conflicting results. We examined the association of rs9939609 variant of FTO gene with obesity and obesity-related anthropometric and metabolic parameters in Pakistani population. Body weight, height, waist circumference, hip circumference, and blood pressure (BP) were measured. BMI and waist-to-hip ratio (WHR) were calculated. Levels of fasting blood glucose (FBG), insulin, leptin, and leptin receptors were measured by enzyme linked immunosorbent assay (ELISA), and homeostasis model assessment of insulin resistance (HOMA-IR) was calculated. The results showed association of FTO gene, rs9939609, with obesity in females (>18 years of age). FTO minor allele increased the risk of obesity by 2.8 times (95% CI = 1.3–6.0) in females. This allele showed association with body weight, BMI, waist circumference, hip circumference, WHR, BP, plasma FBG levels, HOMA-IR, plasma insulin levels, and plasma leptin levels. In conclusion, FTO gene, rs9939609, is associated with BMI and risk of obesity in adult Pakistani females. Association of rs9939609 variant with higher FBG, plasma insulin, and leptin levels indicates that this polymorphism may disturb the metabolism in adult females and predispose them to obesity and type 2 diabetes. However, the above-mentioned findings were not seen in children or males. Adeela Shahid, Sobia Rana, Shahid Saeed, Muhammad Imran, Nasir Afzal, and Saqib Mahmood Copyright © 2013 Adeela Shahid et al. All rights reserved. Transcription Regulation of Plastid Genes Involved in Sulfate Transport in Viridiplantae Thu, 29 Aug 2013 11:32:41 +0000 This study considers transcription regulation of plastid genes involved in sulfate transport in the parasites of invertebrate (Helicosporidium sp.) and other species of the Viridiplantae. A one-box conserved motif with the consensus TAAWATGATT is found near promoters upstream the cysT and cysA genes in many species. In certain cases, the motif is repeated two or three times. Vassily A. Lyubetsky, Alexander V. Seliverstov, and Oleg A. Zverkov Copyright © 2013 Vassily A. Lyubetsky et al. All rights reserved. Inferring Phylogenetic Networks from Gene Order Data Wed, 28 Aug 2013 15:05:02 +0000 Existing algorithms allow us to infer phylogenetic networks from sequences (DNA, protein or binary), sets of trees, and distance matrices, but there are no methods to build them using the gene order data as an input. Here we describe several methods to build split networks from the gene order data, perform simulation studies, and use our methods for analyzing and interpreting different real gene order datasets. All proposed methods are based on intermediate data, which can be generated from genome structures under study and used as an input for network construction algorithms. Three intermediates are used: set of jackknife trees, distance matrix, and binary encoding. According to simulations and case studies, the best intermediates are jackknife trees and distance matrix (when used with Neighbor-Net algorithm). Binary encoding can also be useful, but only when the methods mentioned above cannot be used. Alexey Anatolievich Morozov, Yuri Pavlovich Galachyants, and Yelena Valentinovna Likhoshway Copyright © 2013 Alexey Anatolievich Morozov et al. All rights reserved. Combinatorial Control of Gene Expression Tue, 27 Aug 2013 08:55:09 +0000 The complexity and diversity of eukaryotic organisms are a feat of nature’s engineering. Pulling the strings of such an intricate machinery requires an even more masterful and crafty approach. Only the number and type of responses that they generate exceed the staggering proportions of environmental signals perceived and processed by eukaryotes. Hence, at first glance, the cell’s sparse stockpile of controlling factors does not seem remotely adequate to carry out this response. The question as to how eukaryotes sense and respond to environmental cues has no single answer. It is an amalgamation, an interplay between several processes, pathways, and factors—a combinatorial control. A short description of some of the most important elements that operate this entire conglomerate is given in this paper. Soumya Bhattacharjee, Kaushik Renganaath, Rajesh Mehrotra, and Sandhya Mehrotra Copyright © 2013 Soumya Bhattacharjee et al. All rights reserved. Comparative Analysis of Context-Dependent Mutagenesis Using Human and Mouse Models Thu, 22 Aug 2013 12:10:38 +0000 Substitution rates strongly depend on their nucleotide context. One of the most studied examples is the excess of C > T mutations in the CG context in various groups of organisms, including vertebrates. Studies on the molecular mechanisms underlying this mutation regularity have provided insights into evolution, mutagenesis, and cancer development. Recently several other hypermutable motifs were identified in the human genome. There is an increased frequency of T > C mutations in the second position of the words ATTG and ATAG and an increased frequency of A > C mutations in the first position of the word ACAA. For a better understanding of evolution, it is of interest whether these mutation regularities are human specific or present in other vertebrates, as their presence might affect the validity of currently used substitution models and molecular clocks. A comprehensive analysis of mutagenesis in 4 bp mutation contexts requires a vast amount of mutation data. Such data may be derived from the comparisons of individual genomes or from single nucleotide polymorphism (SNP) databases. Using this approach, we performed a systematical comparison of mutation regularities within 2–4 bp contexts in Mus musculus and Homo sapiens and uncovered that even closely related organisms may have notable differences in context-dependent mutation regularities. Sofya A. Medvedeva, Alexander Y. Panchin, Andrey V. Alexeevski, Sergey A. Spirin, and Yuri V. Panchin Copyright © 2013 Sofya A. Medvedeva et al. All rights reserved. Effect of Mesenchymal Stem Cells and a Novel Curcumin Derivative on Notch1 Signaling in Hepatoma Cell Line Mon, 19 Aug 2013 11:38:15 +0000 This study was conducted to evaluate the effect of mesenchymal stem cells (MSCs) and a novel curcumin derivative (NCD) on HepG2 cells (hepatoma cell line) and to investigate their effect on Notch1 signaling pathway target genes. HepG2 cells were divided into HepG2 control group, HepG2 cells treated with MSC conditioned medium (MSCs CM), HepG2 cells treated with a NCD, HepG2 cells treated with MSCs CM and NCD, and HepG2 cells treated with MSCs CM (CM of MSCs pretreated with a NCD). Expression of Notch1, Hes1, VEGF, and cyclin D1 was assessed by real-time, reverse transcription-polymerase chain reaction (RT-PCR) in HepG2 cells. In addition, HepG2 proliferation assay was performed in all groups. Notch1 and its target genes (Hes1 and cyclin D1) were downregulated in all treated groups with more suppressive effect in the groups treated with both MSCs and NCD. Also, treated HepG2 cells showed significant decrease in cell proliferation rate. These data suggest that modulation of Notch1 signaling pathway by MSCs and/or NCD can be considered as a therapeutic target in HCC. Mohamed Talaat Abdel Aziz, Hussien Mostafa Khaled, Ali El Hindawi, Nagwa Kamal Roshdy, Laila A. Rashed, Dina Sabry, Amira A. Hassouna, Fatma Taha, and Walaa Ibrahim Ali Copyright © 2013 Mohamed Talaat Abdel Aziz et al. All rights reserved. A Comparison of the Biological Features of Prostate Cancer with (PSA+, PSMA+) Profile according to RKIP Wed, 07 Aug 2013 14:06:27 +0000 Purpose. To investigate differences in the biological features of the most immunoexpressed prostate cancer (PC) profiles (PSA+, PSMA+) according to the RKIP. Methods. 19 PC with dominant Gleason grade ≥8 were studied. Expression of PSA, PSMA, RKIP, Raf-1, MEK-1, ERK-1, ERK-2, p-Akt (T308), p-Akt (S473), NF-κB p50, and NF-κBp65 were detected immunohistochemically. Results. Loss of RKIP in the most immunoexpressed PC (PSA+, PSMA+) profile was associated with increased levels of PSA and PSMA expression. Intensities of immunoreactions to PSA and PSMA were higher in cancer cells negative for RKIP (12.51 ± 1.6 and 34.95 ± 1.92) compared to those positive for RKIP (4.68 ± 1.11 and 28.56 ± 0.91). In parallel, missing RKIP expression in PC patients with PSA+, PSMA+ profile was connected with increased components of both Raf-1/MEK/ERK and NF-κB (p65/p50), whereas Akt is activated independently of RKIP. Conclusions. Although characterized by the same (PSA+, PSMA+) profile, PC phenotype missing the RKIP related to invasive potential and greater biological aggressiveness reflected in overexpression of components of Raf-1/MEK/ERK and NF-κB (p65/p50) in which Akt is activated independently of RKIP. Taking into account the PC phenotypes according to RKIP among PSA-PSMA profiles may improve distinguishing them from cancers that will become more aggressive and therefore adapt the therapeutic strategies in those patients. Awatef Ben Jemaa, Yosra Bouraoui, Sataa Sallami, Yassine Nouira, and Ridha Oueslati Copyright © 2013 Awatef Ben Jemaa et al. All rights reserved. Functions of Heterogeneous Nuclear Ribonucleoproteins in Stem Cell Potency and Differentiation Mon, 29 Jul 2013 13:38:45 +0000 Stem cells possess huge importance in developmental biology, disease modelling, cell replacement therapy, and tissue engineering in regenerative medicine because they have the remarkable potential for self-renewal and to differentiate into almost all the cell types in the human body. Elucidation of molecular mechanisms regulating stem cell potency and differentiation is essential and critical for extensive application. Heterogeneous nuclear ribonucleoproteins (hnRNPs) are modular proteins consisting of RNA-binding motifs and auxiliary domains characterized by extensive and divergent functions in nucleic acid metabolism. Multiple roles of hnRNPs in transcriptional and posttranscriptional regulation enable them to be effective gene expression regulators. More recent findings show that hnRNP proteins are crucial factors implicated in maintenance of stem cell self-renewal and pluripotency and cell differentiation. The hnRNPs interact with certain sequences in target gene promoter regions to initiate transcription. In addition, they recognize 3′UTR or 5′UTR of specific gene mRNA forming mRNP complex to regulate mRNA stability and translation. Both of these regulatory pathways lead to modulation of gene expression that is associated with stem cell proliferation, cell cycle control, pluripotency, and committed differentiation. Qishan Chen, Min Jin, Jianhua Zhu, Qingzhong Xiao, and Li Zhang Copyright © 2013 Qishan Chen et al. All rights reserved. DHA Inhibits Protein Degradation More Efficiently than EPA by Regulating the PPARγ/NFκB Pathway in C2C12 Myotubes Sun, 28 Jul 2013 12:10:57 +0000 This study was conducted to evaluate the mechanism by which n-3 PUFA regulated the protein degradation in C2C12 myotubes. Compared with the BSA control, EPA at concentrations from 400 to 600 µM decreased total protein degradation (). However, the total protein degradation was decreased when the concentrations of DHA ranged from 300 µM to 700 µM (). DHA (400 µM, 24 h) more efficiently decreased the IκBα phosphorylation and increased in the IκBα protein level than 400 µM EPA (). Compared with BSA, 400 µM EPA and DHA resulted in a 47% or 68% induction of the NFκB DNA binding activity, respectively (). Meanwhile, 400 µM EPA and DHA resulted in a 1.3-fold and 2.0-fold induction of the PPARγ expression, respectively (). In C2C12 myotubes for PPARγ knockdown, neither 400 µM EPA nor DHA affected the levels of p-IκBα, total IκBα or NFκB DNA binding activity compared with BSA (). Interestingly, EPA and DHA both still decreased the total protein degradation, although PPARγ knockdown attenuated the suppressive effects of EPA and DHA on the total protein degradation (). These results revealed that DHA inhibits protein degradation more efficiently than EPA by regulating the PPARγ/NF-κB pathway in C2C12 myotubes. Yue Wang, Qiao-wei Lin, Pei-pei Zheng, Jian-song Zhang, and Fei-ruo Huang Copyright © 2013 Yue Wang et al. All rights reserved. Bisphenol A Modifies the Regulation Exerted by Testosterone on 5α-Reductase Isozymes in Ventral Prostate of Adult Rats Thu, 25 Jul 2013 14:42:33 +0000 The development, growth, and function of the prostate gland depend on androgen stimulation. The primary androgen in prostate is 5-dihydrotestosterone (DHT) which is synthesized from circulating testosterone (T) through the action of 5-reductase (5-R). Although 5-R occurs as five isozymes, only 5-R1 and 5-R2 are physiologically involved in steroidogenesis. The endocrine disruptor bisphenol A (BPA) alters sexual organs, including the prostate. Our previous findings indicated that BPA decreased the expression of 5-R1 and 5-R2 in rat prostate but also circulating T. Thus, it is unclear whether BPA exerts this effect on 5-R isozymes by reducing circulating T or by any other mechanism. In this study, we examine the effects of short-term exposure to BPA at doses below 25 g/Kg/d and above 300 g/Kg/d of the TDI on mRNA levels of 5-R1 and 5-R2 in prostate of adult castrated rats supplemented with T to achieve constant circulating T levels. mRNA levels were measured by absolute quantitative RT-PCR, T levels by RIA, and DHT levels by ELISA. Our results indicated that in castrated rats treated with T BPA at the two doses studied significantly decreased the mRNA levels of both 5-R isozymes in a dose-dependent manner without modifications in circulating T. Pilar Sánchez, Beatriz Castro, Jesús M. Torres, Asunción Olmo, Raimundo G. del Moral, and Esperanza Ortega Copyright © 2013 Pilar Sánchez et al. All rights reserved. Purity and Enrichment of Laser-Microdissected Midbrain Dopamine Neurons Thu, 25 Jul 2013 11:20:25 +0000 The ability to microdissect individual cells from the nervous system has enormous potential, as it can allow for the study of gene expression in phenotypically identified cells. However, if the resultant gene expression profiles are to be accurately ascribed, it is necessary to determine the extent of contamination by nontarget cells in the microdissected sample. Here, we show that midbrain dopamine neurons can be laser-microdissected to a high degree of enrichment and purity. The average enrichment for tyrosine hydroxylase (TH) gene expression in the microdissected sample relative to midbrain sections was approximately 200-fold. For the dopamine transporter (DAT) and the vesicular monoamine transporter type 2 (Vmat2), average enrichments were approximately 100- and 60-fold, respectively. Glutamic acid decarboxylase (Gad65) expression, a marker for GABAergic neurons, was several hundredfold lower than dopamine neuron-specific genes. Glial cell and glutamatergic neuron gene expression were not detected in microdissected samples. Additionally, SN and VTA dopamine neurons had significantly different expression levels of dopamine neuron-specific genes, which likely reflects functional differences between the two cell groups. This study demonstrates that it is possible to laser-microdissect dopamine neurons to a high degree of cell purity. Therefore gene expression profiles can be precisely attributed to the targeted microdissected cells. Amanda L. Brown, Trevor A. Day, Christopher V. Dayas, and Doug W. Smith Copyright © 2013 Amanda L. Brown et al. All rights reserved. Genotype-Specific Changes in Vitamin B6 Content and the PDX Family in Potato Thu, 18 Jul 2013 10:51:17 +0000 Vitamin B6 is one of the most versatile cofactors in plants and an essential phytonutrient in the human diet that benefits a variety of human health aspects. Although biosynthesis of the vitamin has been well resolved in recent years, the main research is currently based on Arabidopsis thaliana with very little work done on major crop plants. Here we provide the first report on interactions and expression profiles of PDX genes for vitamin B6 biosynthesis in potato and how vitamin B6 content varies in tubers of different genotypes. The results demonstrate that potato is an excellent resource for this vitamin and that strong natural variation in vitamin B6 content among the tested cultivars indicates high potential to fortify vitamin B6 nutrition in potato-based foods. Sutton Mooney, Liyuan Chen, Christina Kühn, Roy Navarre, N. Richard Knowles, and Hanjo Hellmann Copyright © 2013 Sutton Mooney et al. All rights reserved. Identification and Characterization of Cyclic AMP Response Element-Binding Protein H Response Element in the Human Apolipoprotein A5 Gene Promoter Wed, 17 Jul 2013 09:22:40 +0000 The cyclic AMP response element-binding protein H (CREBH) plays important roles in hepatic lipogenesis, fatty acid oxidation, and lipolysis under metabolic stress. Here, we report CREBH as a novel regulator of human APOA5. Knockdown of endogenous CREBH expression via small interfering RNA resulted in the downregulation of human APOA5 mRNA expression in human hepatoma cells, HepG2. Sequence analysis suggested that putative CREBH response element (CREBHRE) is located in the human APOA5 promoter region and is highly conserved in both human and rodent. To clarify whether the human APOA5 promoter is regulated by CREBH, we analyzed the human APOA5 promoter region using a transient transfection assay and determined that transfection of CREBH induced human APOA5 promoter activity. Moreover, it was shown that CREBH directly regulated human APOA5 gene expression by binding to a unique CREBHRE located in the proximal human APOA5 promoter region, using 5′-deletion and mutagenesis of human APOA5 promoter analysis and chromatin immunoprecipitation assay. Taken together, our results demonstrated that human APOA5 is directly regulated by CREBH via CREBHRE and provided a new insight into the role of this liver-specific bZIP transcription factor in lipoprotein metabolism and triglyceride homeostasis. Kwang Hoon Song, Ah-Yeon Park, Ji-Eun Kim, and Jin Yeul Ma Copyright © 2013 Kwang Hoon Song et al. All rights reserved. miR-1279, miR-548j, miR-548m, and miR-548d-5p Binding Sites in CDSs of Paralogous and Orthologous PTPN12, MSH6, and ZEB1 Genes Tue, 16 Jul 2013 10:57:01 +0000 Only PTPN12, MSH6, and ZEB1 have significant miR-1279 binding sites among paralogous genes of human tyrosine phosphatase family, DNA mismatch repair family, and zinc finger family, respectively. All miRNA binding sites are located within CDSs of studied mRNAs. Nucleotide sequences of hsa-miR-1279 binding sites with mRNAs of human PTPN12, MSH6, and ZEB1 genes encode TKEQYE, EGSSDE, and GEKPYE oligopeptides, respectively. The conservation of miRNA binding sites encoding oligopeptides has been revealed. MRNAs of many paralogs of zinc finger gene family have from 1 to 12 binding sites coding the same GEKPYE hexapeptide. MRNAs of PTPN12, MSH6, and ZEB1 orthologous genes from different animal species have binding sites for hsa-miR-1279 which consist of homologous oligonucleotides encoding similar human oligopeptides TKEQYE, EGSSDE, and GEKPYE. MiR-548j, miR-548m, and miR-548d-5p have homologous binding sites in the mRNA of PTPN12 orthologous genes which encode PRTRSC, TEATDI, and STASAT oligopeptides, respectively. All regions of miRNA are important for binding with the mRNA. Anatoliy T. Ivashchenko, Assel S. Issabekova, and Olga A. Berillo Copyright © 2013 Anatoliy T. Ivashchenko et al. All rights reserved. miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes Thu, 11 Jul 2013 13:56:09 +0000 We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family. Assyl Bari, Saltanat Orazova, and Anatoliy Ivashchenko Copyright © 2013 Assyl Bari et al. All rights reserved. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization Tue, 09 Jul 2013 11:26:40 +0000 Virulence is the primary factor used for selection of entomopathogenic fungi (EPF) for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates. Saliou Niassy, Sevgan Subramanian, Sunday Ekesi, Joel L. Bargul, Jandouwe Villinger, and Nguya K. Maniania Copyright © 2013 Saliou Niassy et al. All rights reserved. Erratum to “DNA, RNA, and Protein Extraction: The Past and the Present” Wed, 26 Jun 2013 13:50:28 +0000 Siun Chee Tan and Beow Chin Yiap Copyright © 2013 Siun Chee Tan and Beow Chin Yiap. All rights reserved. Molecular Functions of Thyroid Hormones and Their Clinical Significance in Liver-Related Diseases Wed, 26 Jun 2013 13:35:35 +0000 Thyroid hormones (THs) are potent mediators of several physiological processes, including embryonic development, cellular differentiation, metabolism, and cell growth. Triiodothyronine (T3) is the most biologically active TH form. Thyroid hormone receptors (TRs) belong to the nuclear receptor superfamily and mediate the biological functions of T3 via transcriptional regulation. TRs generally form heterodimers with the retinoid X receptor (RXR) and regulate target genes upon T3 stimulation. Research over the past few decades has revealed that disruption of cellular TH signaling triggers chronic liver diseases, including alcoholic or nonalcoholic fatty liver disease and hepatocellular carcinoma (HCC). Animal model experiments and epidemiologic studies to date imply close associations between high TH levels and prevention of liver disease. Moreover, several investigations spanning four decades have reported the therapeutic potential of T3 analogs in lowering lipids, preventing chronic liver disease, and as anticancer agents. Thus, elucidating downstream genes/signaling pathways and molecular mechanisms of TH actions is critical for the treatment of significant public health issues. Here, we have reviewed recent studies focusing on the roles of THs and TRs in several disorders, in particular, liver diseases. We also discuss the potential therapeutic applications of THs and underlying molecular mechanisms. Hsiang Cheng Chi, Cheng-Yi Chen, Ming-Ming Tsai, Chung-Ying Tsai, and Kwang-Huei Lin Copyright © 2013 Hsiang Cheng Chi et al. All rights reserved. Molecular Fingerprints to Identify Candida Species Mon, 17 Jun 2013 18:48:38 +0000 A wide range of molecular techniques have been developed for genotyping Candida species. Among them, multilocus sequence typing (MLST) and microsatellite length polymorphisms (MLP) analysis have recently emerged. MLST relies on DNA sequences of internal regions of various independent housekeeping genes, while MLP identifies microsatellite instability. Both methods generate unambiguous and highly reproducible data. Here, we review the results achieved by using these two techniques and also provide a brief overview of a new method based on high-resolution DNA melting (HRM). This method identifies sequence differences by subtle deviations in sample melting profiles in the presence of saturating fluorescent DNA binding dyes. Claudia Spampinato and Darío Leonardi Copyright © 2013 Claudia Spampinato and Darío Leonardi. All rights reserved. Origin and Status of Homologous Proteins of Biomineralization (Biosilicification) in the Taxonomy of Phylogenetic Domains Thu, 13 Jun 2013 15:39:57 +0000 The taxonomic affiliation (in the systematisation of viruses, and biological domains) of known peptides and proteins of biomineralization (silicateins, silaffins, silacidins and silicase) and their primary structure homologues were analyzed (methods in silico; using Uniprot database). The total number of known peptides and proteins of biosilicification was counted. The data of the quantitative distribution of the detected homologues found in nature are presented. The similarity of the primary structures of silaffins, silacidins, silicateins, silicase, and their homologues was 21–94%, 45–98%, 39–50%, and 28–40%, respectively. These homologues are found in many organisms, from the Protista to the higher plants and animals, including humans, as well as in bacteria and extracellular agents, and they perform a variety of biological functions, such as biologically controlled mineralisation. The provisional classification of these biomineralization proteins is presented. The interrelation of the origin of the first organic polymers and biomineralization is discussed. Igor E. Pamirsky and Kirill S. Golokhvast Copyright © 2013 Igor E. Pamirsky and Kirill S. Golokhvast. All rights reserved. Comparison between the Repression Potency of siRNA Targeting the Coding Region and the 3′-Untranslated Region of mRNA Wed, 12 Jun 2013 09:49:15 +0000 Small interfering RNAs (siRNAs) are applied for post-transcriptional gene silencing by binding target mRNA. A target coding region is usually chosen, although the -untranslated region (-UTR) can also be a target. This study elucidates whether the coding region or -UTR elicits higher repression. pFLuc and pRLuc are two reporter plasmids. A segment of FLuc gene was PCR-amplified and inserted behind the stop codon of the RLuc gene of the pRLuc. Similarly, a segment of RLuc gene was inserted behind the stop codon of FLuc. Two siFLuc and two siRLuc were siRNAs designed to target the central portions of these segments. Therefore, the siRNA encountered the same targets and flanking sequences. Results showed that the two siFLuc elicited higher repression when the FLuc segment resided in the coding region. Conversely, the two siRLuc showed higher repression when the RLuc segment was in the -UTR. These results indicate that both the coding region and the -UTR can be more effective targets. The thermodynamic stability of the secondary structures was analyzed. The siRNA elicited higher repression in the coding region when the target configuration was stable, and needed to be solved by translation. A siRNA may otherwise favor the target at -UTR. Ching-Fang Lai, Chih-Ying Chen, and Lo-Chun Au Copyright © 2013 Ching-Fang Lai et al. All rights reserved. Stability and Accuracy Assessment of Identification of Traditional Chinese Materia Medica Using DNA Barcoding: A Case Study on Flos Lonicerae Japonicae Wed, 05 Jun 2013 15:23:26 +0000 DNA barcoding is a novel molecular identification method that aids in identifying traditional Chinese materia medica using traditional identification techniques. However, further study is needed to assess the stability and accuracy of DNA barcoding. Flos Lonicerae Japonicae, a typical medicinal flower, is widely used in China, Korea, and other Southeast Asian countries. However, Flos Lonicerae Japonicae and its closely related species have been misused and traded at varying for a wide range of prices. Therefore, Flos Lonicerae Japonicae must be accurately identified. In this study, the ITS2 and psbA-trnH regions were amplified by polymerase chain reaction (PCR). Sequence assembly was performed using CodonCode Aligner V 3.5.4. The intra- versus inter-specific variations were assessed using six metrics and “barcoding gaps.” Species identification was conducted using BLAST1 and neighbor-joining (NJ) trees. Results reveal that ITS2 and psbA-trnH exhibited an average intraspecific divergence of 0.001 and 0, respectively, as well as an average inter-specific divergence of 0.0331 and 0.0161. The identification efficiency of ITS2 and psbA-trnH evaluated using BLAST1 was 100%. Flos Lonicerae Japonicae was formed into one clade through the NJ trees. Therefore, Flos Lonicerae Japonicae can be stably and accurately identified through the ITS2 and psbA-trnH regions, respectively. Dianyun Hou, Jingyuan Song, Linchun Shi, Xiaochong Ma, Tianyi Xin, Jianping Han, Wei Xiao, Zhiying Sun, Ruiyang Cheng, and Hui Yao Copyright © 2013 Dianyun Hou et al. All rights reserved. Molecular Identification and Ultrastructural and Phylogenetic Studies of Cyanobacteria from Association with the White Sea Hydroid Dynamena pumila (L., 1758) Wed, 22 May 2013 14:55:38 +0000 Three new cyanobacterial strains, that have been previously purified from the hydroid Dynamena pumila (L., 1758), isolated from the White Sea, were studied using scanning and transmission electron microscopy methods and were characterized by using almost complete sequence of the 16S rRNA gene, internal transcribed spacer 16S-23S rRNA, and part of the gene for 23S rRNA. The full nucleotide sequences of the rRNA gene clusters were deposited to GenBank (HM064496.1, GU265558.1, JQ259187.1). Comparison of rRNA gene cluster sequences of Synechococcus cyanobacterium 1Dp66E-1, Oscillatoriales cyanobacterium 2Dp86E, and Nostoc sp. 10Dp66E with all sequences present at the GenBank shows that these cyanobacterial strains do not have 100% identity with any organisms investigated previously. Furthermore, for the first time heterotrophic bacterium, associated with Nostoc sp. 10Dp66E, was identified as a member of the new phylum Gemmatimonadetes, genus of Gemmatimonas (GenBank accession number is JX437625.1). Phylogenetic analysis showed that cyanobacterium Synechococcus sp. 1Dp66E-1 forms the unique branch and belongs to a cluster of Synechococcus, including freshwater and sea strains. Oscillatoriales cyanobacterium 2Dp86E belongs to a cluster of Leptolyngbya strains. Isolate Nostoc sp. 10Dp66E forms unique branch and belongs to a cluster of the genus Nostoc, with the closest relative of Nostoc commune isolates. O. A. Koksharova, T. R. Kravzova, I. V. Lazebnaya, O. A. Gorelova, O. I. Baulina, O. E. Lazebny, T. A. Fedorenko, and E. S. Lobakova Copyright © 2013 O. A. Koksharova et al. All rights reserved. Analytical Methodologies for the Determination of Endocrine Disrupting Compounds in Biological and Environmental Samples Wed, 08 May 2013 16:40:27 +0000 Endocrine-disruptor compounds (EDCs) can mimic natural hormones and produce adverse effects in the endocrine functions by interacting with estrogen receptors. EDCs include both natural and synthetic chemicals, such as hormones, personal care products, surfactants, and flame retardants, among others. EDCs are characterised by their ubiquitous presence at trace-level concentrations and their wide diversity. Since the discovery of the adverse effects of these pollutants on wildlife and human health, analytical methods have been developed for their qualitative and quantitative determination. In particular, mass-based analytical methods show excellent sensitivity and precision for their quantification. This paper reviews recently published analytical methodologies for the sample preparation and for the determination of these compounds in different environmental and biological matrices by liquid chromatography coupled with mass spectrometry. The various sample preparation techniques are compared and discussed. In addition, recent developments and advances in this field are presented. Zoraida Sosa-Ferrera, Cristina Mahugo-Santana, and José Juan Santana-Rodríguez Copyright © 2013 Zoraida Sosa-Ferrera et al. All rights reserved. Construction and Preliminary Characterization Analysis of Wuzhishan Miniature Pig Bacterial Artificial Chromosome Library with Approximately 8-Fold Genome Equivalent Coverage Thu, 18 Apr 2013 13:49:49 +0000 Bacterial artificial chromosome (BAC) libraries have been invaluable tools for the genome-wide genetic dissection of complex organisms. Here, we report the construction and characterization of a high-redundancy BAC library from a very valuable pig breed in China, Wuzhishan miniature pig (Sus scrofa), using its blood cells and fibroblasts, respectively. The library contains approximately 153,600 clones ordered in 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 152.3 kb, representing approximately 7.68 genome equivalents of the porcine haploid genome and a 99.93% statistical probability of obtaining at least one clone containing a unique DNA sequence in the library. 19 pairs of microsatellite marker primers covering porcine chromosomes were used for screening the BAC library, which showed that each of these markers was positive in the library; the positive clone number was 2 to 9, and the average number was 7.89, which was consistent with 7.68-fold coverage of the porcine genome. And there were no significant differences of genomic BAC library from blood cells and fibroblast cells. Therefore, we identified 19 microsatellite markers that could potentially be used as genetic markers. As a result, this BAC library will serve as a valuable resource for gene identification, physical mapping, and comparative genomics and large-scale genome sequencing in the porcine. Changqing Liu, Yuo Guo, Taofeng Lu, Hongmei Wu, Risu Na, Xiangchen Li, Weijun Guan, and Yuehui Ma Copyright © 2013 Changqing Liu et al. All rights reserved. Development of an Ammonium Sulfate DNA Extraction Method for Obtaining Amplifiable DNA in a Small Number of Cells and Its Application to Clinical Specimens Wed, 17 Apr 2013 08:40:33 +0000 DNA extraction from microdissected cells has become essential for handling clinical specimens with advances in molecular pathology. Conventional methods have limitations for extracting amplifiable DNA from specimens containing a small number of cells. We developed an ammonium sulfate DNA extraction method (A) and compared it with two other methods (B and C). DNA quality and quantity, β-globin amplification, and detectability of two cancer associated gene mutations were evaluated. Method A showed the best DNA yield, particularly when the cell number was very low. Amplification of the β-globin gene using DNA from the SNU 790 cell line and papillary thyroid carcinoma (PTC) cells extracted with Method A demonstrated the strongest band. BRAFV600E mutation analysis using ethanol-fixed PTC cells from a patient demonstrated both a “T” peak increase and an adjacent “A” peak decrease when 25 and 50 cells were extracted, whereas mutant peaks were too low to be analyzed using the other two methods. EGFR mutation analysis using formalin-fixed paraffin-embedded lung cancer tissues demonstrated a mutant peak with Method A, whereas the mutant peak was undetectable with Methods B or C. Method A yielded the best DNA quantity and quality with outstanding efficiency, particularly when paucicellular specimens were used. Seo Young Oh, Wook Youn Kim, Tae Sook Hwang, Hye Seung Han, So Dug Lim, and Wan Seop Kim Copyright © 2013 Seo Young Oh et al. All rights reserved. Molecular Techniques for Dicistrovirus Detection without RNA Extraction or Purification Thu, 04 Apr 2013 16:21:53 +0000 Dicistroviridae is a new family of small, nonenveloped, and +ssRNA viruses pathogenic to both beneficial arthropods and insect pests as well. Triatoma virus (TrV), a dicistrovirus, is a pathogen of Triatoma infestans (Hemiptera: Reduviidae), one of the main vectors of Chagas disease. In this work, we report a single-step method to identify TrV, a dicistrovirus, isolated from fecal samples of triatomines. The identification method proved to be quite sensitive, even without the extraction and purification of RNA virus. Jailson F. B. Querido, Jon Agirre, Gerardo A. Marti, Diego M. A. Guérin, and Marcelo Sousa Silva Copyright © 2013 Jailson F. B. Querido et al. All rights reserved. Titanium Surface Coating with a Laminin-Derived Functional Peptide Promotes Bone Cell Adhesion Mon, 25 Mar 2013 12:41:55 +0000 Laminin-derived peptide coatings can enhance epithelial cell adhesion to implants, and the positive effect of these peptides on bone cell adhesion has been anticipated. The purpose of this study was to evaluate the improvement in bone cell attachment to and activity on titanium (Ti) scaffolds coated with a laminin-derived functional peptide, Ln2-P3 (the DLTIDDSYWYRI motif). Four Ti disc surfaces were prepared, and a human osteosarcoma (HOS) cell attachment test was performed to select two candidate surfaces for peptide coating. These two candidates were then coated with Ln2-P3 peptide, a scrambled peptide, or left uncoated to measure cell attachment to each surface, following which one surface was chosen to assess alkaline phosphatase (ALP) activity and osteogenic marker gene expression with quantitative real-time PCR. On the commercially pure Ti surface, the Ln2-P3 coating significantly increased cellular ALP activity and the expression levels of ALP and bone sialoprotein mRNA as compared with the scrambled peptide-coated and uncoated surfaces. In conclusion, although further in vivo studies are needed, the findings of this in vitro study indicate that the Ln2-P3-coated implant surface promotes bone cell adhesion, which has clinical implications for reducing the overall treatment time of dental implant therapy. Seung-Ki Min, Hyun Ki Kang, Da Hyun Jang, Sung Youn Jung, O. Bok Kim, Byung-Moo Min, and In-Sung Yeo Copyright © 2013 Seung-Ki Min et al. All rights reserved. Adhesion, Growth, and Maturation of Vascular Smooth Muscle Cells on Low-Density Polyethylene Grafted with Bioactive Substances Sun, 24 Mar 2013 10:28:40 +0000 The attractiveness of synthetic polymers for cell colonization can be affected by physical, chemical, and biological modification of the polymer surface. In this study, low-density polyethylene (LDPE) was treated by an Ar+ plasma discharge and then grafted with biologically active substances, namely, glycine (Gly), polyethylene glycol (PEG), bovine serum albumin (BSA), colloidal carbon particles (C), or BSA+C. All modifications increased the oxygen content, the wettability, and the surface free energy of the materials compared to the pristine LDPE, but these changes were most pronounced in LDPE with Gly or PEG, where all the three values were higher than in the only plasma-treated samples. When seeded with vascular smooth muscle cells (VSMCs), the Gly- or PEG-grafted samples increased mainly the spreading and concentration of focal adhesion proteins talin and vinculin in these cells. LDPE grafted with BSA or BSA+C showed a similar oxygen content and similar wettability, as the samples only treated with plasma, but the nano- and submicron-scale irregularities on their surface were more pronounced and of a different shape. These samples promoted predominantly the growth, the formation of a confluent layer, and phenotypic maturation of VSMC, demonstrated by higher concentrations of contractile proteins alpha-actin and SM1 and SM2 myosins. Thus, the behavior of VSMC on LDPE can be regulated by the type of bioactive substances that are grafted. Martin Parizek, Nikola Slepickova Kasalkova, Lucie Bacakova, Zdenek Svindrych, Petr Slepicka, Marketa Bacakova, Vera Lisa, and Vaclav Svorcik Copyright © 2013 Martin Parizek et al. All rights reserved. Antitumoral Potential of Tunisian Snake Venoms Secreted Phospholipases A2 Thu, 31 Jan 2013 13:46:41 +0000 Phospholipases type A2 (PLA2s) are the most abundant proteins found in Viperidae snake venom. They are quite fascinating from both a biological and structural point of view. Despite similarity in their structures and common catalytic properties, they exhibit a wide spectrum of pharmacological activities. Besides being hydrolases, secreted phospholipases A2 (sPLA2) are an important group of toxins, whose action at the molecular level is still a matter of debate. These proteins can display toxic effects by different mechanisms. In addition to neurotoxicity, myotoxicity, hemolytic activity, antibacterial, anticoagulant, and antiplatelet effects, some venom PLA2s show antitumor and antiangiogenic activities by mechanisms independent of their enzymatic activity. This paper aims to discuss original finding against anti-tumor and anti-angiogenic activities of sPLA2 isolated from Tunisian vipers: Cerastes cerastes and Macrovipera lebetina, representing new tools to target specific integrins, mainly, and integrins. Raoudha Zouari-Kessentini, Najet Srairi-Abid, Amine Bazaa, Mohamed El Ayeb, Jose Luis, and Naziha Marrakchi Copyright © 2013 Raoudha Zouari-Kessentini et al. All rights reserved. Understanding the Molecular Mechanism and Structure-Function Relationship of the Toxicity of PLA2 and K49 Homologs in Snake Venom Thu, 31 Jan 2013 13:38:23 +0000 Luis Alberto Ponce-Soto, Laura Leiva, and Elen Cristina Teizem Landucci Copyright © 2013 Luis Alberto Ponce-Soto et al. All rights reserved. Unmasking Snake Venom of Bothrops leucurus: Purification and Pharmacological and Structural Characterization of New PL Bleu TX-III Wed, 09 Jan 2013 10:46:52 +0000 Bleu TX-III was isolated from Bothrops leucurus snake venom on one-step analytical chromatography reverse phase HPLC, was homogeneous on SDS-PAGE, and was confirmed by Q-Tof Ultima API ESI/MS (TOF MS mode) mass spectrometry in 14243.8 Da. Multiple alignments of Bleu TX-III show high degree of homology with basic PLA2 myotoxins from other Bothrops venoms. Our studies on local and systemic myotoxicity “in vivo” reveal that Bleu TX-III is myotoxin with local but not systemic action due to the decrease in the plasmatic CK levels when Bleu TX-III is administrated by intravenous route in mice (dose 1 and 5 μg). And at a dose of 20 μg myotoxin behaves like a local and systemic action. Bleu TX-III induced moderate marked paw edema, evidencing the local increase in vascular permeability. The inflammatory events induced in the mice (I.M.) were investigated. The increase in the levels of IL-1, IL-6, and TNF-α was observed in the plasma. It is concluded that Bleu TX-III induces inflammatory events in this model. The enzymatic phospholipid hydrolysis may be relevant to these phenomena. Bothrops leucurus venom is still not extensively explored, and the knowledge of its toxins separately through the study of structure/function will contribute for a better understanding of its action mechanism. Fábio André Marangoni, Luis Alberto Ponce-Soto, Sergio Marangoni, and Elen Cristina Teizem Landucci Copyright © 2013 Fábio André Marangoni et al. All rights reserved. Molecular Cloning, Expression, Purification, and Functional Characterization of Dammarenediol Synthase from Panax ginseng Sun, 30 Dec 2012 16:46:02 +0000 The objective of this study is to clone and charecterize the expression of dammarenediol synthase gene and then to determine the relationship between the expression of dammarenediol synthase gene that is involved in the ginsenoside biosynthetic pathway and the ginsenoside content. A cDNA phage library was constructed from a five-year-old ginseng root. The cDNA library was screened for the dammarenediol synthase gene by using its specific primers. It was further cloned and expressed in pET-30a vector. The recombinant plasmid pET-30a-DS was expressed in Rosetta E. coli. The recombinant DS protein was purified by affinity chromatography. The production of dammarenediol was detected by liquid chromatography-mass spectrometry (LC-MS). Results showed that dammarenediol synthase gene was cloned from the cDNA library and was expressed in Rosetta E. coli and the SDS-PAGE analysis showed the presence of purified DS protein. LS-MS showed the activity of DS protein, as the protein content increases the dammarenediol increases. Our results indicate that the recombinant dammarenediol synthase protein could increase the production of dammarenediol and the expression of DS played a vital role in the biosynthesis of ginsenosides in P. ginseng. Wei Hu, Ning Liu, Yuhua Tian, and Lianxue Zhang Copyright © 2013 Wei Hu et al. All rights reserved. Biochemical Characterization and Pharmacological Properties of New Basic PLA2 BrTX-I Isolated from Bothrops roedingeri (Roedinger's Lancehead) Mertens, 1942, Snake Venom Sun, 30 Dec 2012 08:57:44 +0000 BrTX-I, a PLA2, was purified from Bothrops roedingeri venom after only one chromatographic step using reverse-phase HPLC on μ-Bondapak C-18 column. A molecular mass of 14358.69 Da was determined by MALDI-TOF mass spectrometry. Amino acid analysis showed a high content of hydrophobic and basic amino acids as well as 14 half-cysteine residues. The total amino acid sequence was obtained using SwissProt database and showed high amino acid sequence identity with other PLA2 from snake venom. The amino acid composition showed that BrTX-I has a high content of Lys, Tyr, Gly, Pro, and 14 half-Cys residues, typical of a basic PLA2. BrTX-I presented PLA2 activity and showed a minimum sigmoidal behavior, reaching its maximal activity at pH 8.0, 35–45°C, and required Ca2+. In vitro, the whole venom and BrTX-I caused a neuromuscular blockade in biventer cervicis preparations in a similar way to other Bothrops species. BrTX-I induced myonecrosis and oedema-forming activity analyzed through injection of the purified BrTX-I in mice. Since BrTX-I exerts a strong proinflammatory effect, the enzymatic phospholipid hydrolysis might be relevant for these phenomena; incrementing levels of IL-1, IL-6, and TNFα were observed at 15 min, 30 min, one, two, and six hours postinjection, respectively. Mauricio Aurelio Gomes Heleno, Paulo Aparecido Baldasso, Luis Alberto Ponce-Soto, and Sérgio Marangoni Copyright © 2013 Mauricio Aurelio Gomes Heleno et al. All rights reserved. Biochemical, Pharmacological, and Structural Characterization of New Basic Bbil-TX from Bothriopsis bilineata Snake Venom Sun, 30 Dec 2012 07:41:48 +0000 Bbil-TX, a PLA2, was purified from Bothriopsis bilineata snake venom after only one chromatographic step using RP-HPLC on μ-Bondapak C-18 column. A molecular mass of 14243.8 Da was confirmed by Q-Tof Ultima API ESI/MS (TOF MS mode) mass spectrometry. The partial protein sequence obtained was then submitted to BLASTp, with the search restricted to PLA2 from snakes and shows high identity values when compared to other PLA2s. PLA2 activity was presented in the presence of a synthetic substrate and showed a minimum sigmoidal behavior, reaching its maximal activity at pH 8.0 and 25–37∘C. Maximum PLA2 activity required Ca2+ and in the presence of Cd2+, Zn2+, Mn2+, and Mg2+ it was reduced in the presence or absence of Ca2+. Crotapotin from Crotalus durissus cascavella rattlesnake venom and antihemorrhagic factor DA2-II from Didelphis albiventris opossum sera under optimal conditions significantly inhibit the enzymatic activity. Bbil-TX induces myonecrosis in mice. The fraction does not show a significant cytotoxic activity in myotubes and myoblasts (C2C12). The inflammatory events induced in the serum of mice by Bbil-TX isolated from Bothriopsis bilineata snake venom were investigated. An increase in vascular permeability and in the levels of TNF-a, IL-6, and IL-1 was was induced. Since Bbil-TX exerts a stronger proinflammatory effect, the phospholipid hydrolysis may be relevant for these phenomena. Victor Corasolla Carregari, Rafael Stuani Floriano, Lea Rodrigues-Simioni, Flavia V. Winck, Paulo Aparecido Baldasso, Luis Alberto Ponce-Soto, and Sergio Marangoni Copyright © 2013 Victor Corasolla Carregari et al. All rights reserved. Synergistic Effects of Secretory Phospholipase A2 from the Venom of Agkistrodon piscivorus piscivorus with Cancer Chemotherapeutic Agents Thu, 27 Dec 2012 08:21:24 +0000 Healthy cells typically resist hydrolysis catalyzed by snake venom secretory phospholipase A2. However, during various forms of programmed cell death, they become vulnerable to attack by the enzyme. This observation raises the question of whether the specificity of the enzyme for dying cells could be used as a strategy to eliminate tumor cells that have been intoxicated but not directly killed by chemotherapeutic agents. This idea was tested with S49 lymphoma cells and a broad range of antineoplastic drugs: methotrexate, daunorubicin, actinomycin D, and paclitaxel. In each case, a substantial population of treated cells was still alive yet vulnerable to attack by the enzyme. Induction of cell death by these agents also perturbed the biophysical properties of the membrane as detected by merocyanine 540 and trimethylammonium-diphenylhexatriene. These results suggest that exposure of lymphoma cells to these drugs universally causes changes to the cell membrane that render it susceptible to enzymatic attack. The data also argue that the snake venom enzyme is not only capable of clearing cell corpses but can aid in the demise of tumor cells that have initiated but not yet completed the death process. Jennifer Nelson, Kristen Barlow, D. Olin Beck, Amanda Berbert, Nathan Eshenroder, Lyndee Francom, Mark Pruitt, Kina Thompson, Kyle Thompson, Brian Thurber, Celestine H.-Y. Yeung, Allan M. Judd, and John D. Bell Copyright © 2013 Jennifer Nelson et al. All rights reserved. Biochemical Characterization, Action on Macrophages, and Superoxide Anion Production of Four Basic Phospholipases A2 from Panamanian Bothrops asper Snake Venom Mon, 24 Dec 2012 07:50:21 +0000 Bothrops asper (Squamata: Viperidae) is the most important venomous snake in Central America, being responsible for the majority of snakebite accidents. Four basic PLA2s (pMTX-I to -IV) were purified from crude venom by a single-step chromatography using a CM-Sepharose ion-exchange column (1.5 × 15 cm). Analysis of the N-terminal sequence demonstrated that pMTX-I and III belong to the catalytically active Asp49 phospholipase A2 subclass, whereas pMTX-II and IV belong to the enzymatically inactive Lys49 PLA2s-like subclass. The PLA2s isolated from Panama Bothrops asper venom (pMTX-I, II, III, and IV) are able to induce myotoxic activity, inflammatory reaction mainly leukocyte migration to the muscle, and induce J774A.1 macrophages activation to start phagocytic activity and superoxide production. Aristides Quintero Rueda, Isela González Rodríguez, Eliane C. Arantes, Sulamita S. Setúbal, Leonardo de A. Calderon, Juliana P. Zuliani, Rodrigo G. Stábeli, and Andreimar M. Soares Copyright © 2013 Aristides Quintero Rueda et al. All rights reserved. A Lys49 Phospholipase , Isolated from Bothrops asper Snake Venom, Induces Lipid Droplet Formation in Macrophages Which Depends on Distinct Signaling Pathways and the C-Terminal Region Mon, 24 Dec 2012 07:36:13 +0000 MT-II, a Lys49PLA2 homologue devoid of catalytic activity from B. asper venom, stimulates inflammatory events in macrophages. We investigated the ability of MT-II to induce formation of lipid droplets (LDs), key elements of inflammatory responses, in isolated macrophages and participation of protein kinases and intracellular PLA2s in this effect. Influence of MT-II on PLIN2 recruitment and expression was assessed, and the effects of some synthetic peptides on LD formation were further evaluated. At noncytotoxic concentrations, MT-II directly activated macrophages to form LDs. This effect was reproduced by a synthetic peptide corresponding to the C-terminal sequence 115–129 of MT-II, evidencing the critical role of C-terminus for MT-II-induced effect. Moreover, MT-II induced expression and recruitment of PLIN2. Pharmacological interventions with specific inhibitors showed that PKC, PI3K, ERK1/2, and iPLA2, but not or cPLA2, signaling pathways are involved in LD formation induced by MT-II. This sPLA2 homologue also induced synthesis of PGE2 that colocalized to LDs. In conclusion, MT-II is able to induce formation of LDs committed to PGE2 formation in a process dependent on C-terminal loop engagement and regulated by distinct protein kinases and iPLA2. LDs may constitute an important inflammatory mechanism triggered by MT-II in macrophages. Karina Cristina Giannotti, Elbio Leiguez, Vanessa Moreira, Neide Galvão Nascimento, Bruno Lomonte, José Maria Gutiérrez, Robson Lopes de Melo, and Catarina Teixeira Copyright © 2013 Karina Cristina Giannotti et al. All rights reserved. Induction of Mast-Cell Accumulation by Promutoxin, an Arg-49 Phospholipase Thu, 20 Dec 2012 16:26:34 +0000 Local inflammation is a prominent characteristic of snakebite wound, and snake-venom phospholipase A2s (PLA2s) are some of the main component that contribute to accumulation of inflammatory cells. However, the action of an R49 PLA2s, promutoxin from Protobothrops mucrosquamatus venom, on mast-cell accumulation has not been previously examined. Using a mouse peritoneal model, we found that promutoxin can induce approximately-6-fold increase in mast-cell accumulation, and the response lasts at least for 16 h. The promutoxin-induced mast cell accumulation was inhibited by cyproheptadine, terfenadine, and Ginkgolide B, indicating that histamine and platelet-activating factor (PAF) is likely to contribute to the mast-cells accumulation. Preinjection of antibodies against adhesion molecules ICAM-1, CD18, CD11a, and L-selectin showed that ICAM-1, and CD18, CD11a are key adhesion molecules of promutoxin-induced mast-cell accumulation. In conclusion, promutoxin can induce accumulation of mast cells, which may contribute to snake-venom wound. Ji-Fu Wei, Xiao-Long Wei, Ya-Zhen Mo, Haiwei Yang, and Shaoheng He Copyright © 2013 Ji-Fu Wei et al. All rights reserved. A Versatile Star PEG Grafting Method for the Generation of Nonfouling and Nonthrombogenic Surfaces Thu, 20 Dec 2012 08:09:04 +0000 Polyethylene glycol (PEG) grafting has a great potential to create nonfouling and nonthrombogenic surfaces, but present techniques lack versatility and stability. The present work aimed to develop a versatile PEG grafting method applicable to most biomaterial surfaces, by taking advantage of novel primary amine-rich plasma-polymerized coatings. Star-shaped PEG covalent binding was studied using static contact angle, X-ray photoelectron spectroscopy (XPS), and quartz crystal microbalance with dissipation monitoring (QCM-D). Fluorescence and QCM-D both confirmed strong reduction of protein adsorption when compared to plasma-polymerized coatings and pristine poly(ethyleneterephthalate) (PET). Moreover, almost no platelet adhesion was observed after 15 min perfusion in whole blood. Altogether, our results suggest that primary amine-rich plasma-polymerized coatings offer a promising stable and versatile method for PEG grafting in order to create nonfouling and nonthrombogenic surfaces and micropatterns. Pradeep Kumar Thalla, Angel Contreras-García, Hicham Fadlallah, Jérémie Barrette, Gregory De Crescenzo, Yahye Merhi, and Sophie Lerouge Copyright © 2013 Pradeep Kumar Thalla et al. All rights reserved. Chemical Modifications of PhTX-I Myotoxin from Porthidium hyoprora Snake Venom: Effects on Structural, Enzymatic, and Pharmacological Properties Wed, 19 Dec 2012 15:33:40 +0000 We recently described the isolation of a basic PLA2 (PhTX-I) from Porthidium hyoprora snake venom. This toxin exhibits high catalytic activity, induces in vivo myotoxicity, moderates footpad edema, and causes in vitro neuromuscular blockade. Here, we describe the chemical modifications of specific amino acid residues (His, Tyr, Lys, and Trp), performed in PhTX-I, to study their effects on the structural, enzymatic, and pharmacological properties of this myotoxin. After chemical treatment, a single His, 4 Tyr, 7 Lys, and one Trp residues were modified. The secondary structure of the protein remained unchanged as measured by circular dichroism; however other results indicated the critical role played by Lys and Tyr residues in myotoxic, neurotoxic activities and mainly in the cytotoxicity displayed by PhTX-I. His residue and therefore catalytic activity of PhTX-I are relevant for edematogenic, neurotoxic, and myotoxic effects, but not for its cytotoxic activity. This dissociation observed between enzymatic activity and some pharmacological effects suggests that other molecular regions distinct from the catalytic site may also play a role in the toxic activities exerted by this myotoxin. Our observations supported the hypothesis that both the catalytic sites as the hypothetical pharmacological sites are relevant to the pharmacological profile of PhTX-I. Salomón Huancahuire-Vega, Daniel H. A. Corrêa, Luciana M. Hollanda, Marcelo Lancellotti, Carlos H. I. Ramos, Luis Alberto Ponce-Soto, and Sergio Marangoni Copyright © 2013 Salomón Huancahuire-Vega et al. All rights reserved. A MicroRNA Component of the Neoplastic Microenvironment: Microregulators with Far-Reaching Impact Tue, 04 Dec 2012 16:33:51 +0000 The interplay between tumor cells and their microenvironment plays a pivotal role in tumor development and progression. Although a growing body of evidence has established the importance of the tumor microenvironment, an understanding of the crosstalk between its components and cancer cells remains elusive. The pathways triggered by microenvironmental factors could modulate cancer-related gene transcription, also affecting small noncoding RNAs, microRNAs, which have emerged as key posttranscriptional regulators of gene expression, directly involved in human cancers. Although microRNAs regulate most biological mechanisms, their role in the tumor microenvironment has only recently become the focus of intense research. In this paper, we focus on the intertwined connection between the tumor microenvironment and aberrant expression of microRNAs involved in carcinogenesis. We also discuss the emerging roles of microRNAs in the tumor microenvironment as it relates to cancer progression. We conclude that microRNAs are critical for our understanding of the development of cancer, and that targeting microRNA signaling pathways in the microenvironment as well as in tumor cells opens new therapeutic avenues to the global control of cancer. Xiaolei Li, Zhiqiang Wu, Xiaobing Fu, and Weidong Han Copyright © 2013 Xiaolei Li et al. All rights reserved. Increased Expression of microRNA-17 Predicts Poor Prognosis in Human Glioma Mon, 19 Nov 2012 17:12:32 +0000 Aim. To investigate the clinical significance of microRNA-17 (miR-17) expression in human gliomas. Methods. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to characterize the expression patterns of miR-17 in 108 glioma and 20 normal brain tissues. The associations of miR-17 expression with clinicopathological factors and prognosis of glioma patients were also statistically analyzed. Results. Compared with normal brain tissues, miR-17 expression was significantly higher in glioma tissues (). In addition, the increased expression of miR-17 in glioma was significantly associated with advanced pathological grade () and low Karnofsky performance score (KPS, ). Moreover, Kaplan-Meier survival and Cox regression analyses showed that miR-17 overexpression () and advanced pathological grade () were independent factors predicting poor prognosis for gliomas. Furthermore, subgroup analyses showed that miR-17 expression was significantly associated with poor overall survival in glioma patients with high pathological grades (for grade III~IV: ). Conclusions. Our data offer the convinced evidence that the increased expression of miR-17 may have potential value for predicting poor prognosis in glioma patients with high pathological grades, indicating that miR-17 may contribute to glioma progression and be a candidate therapeutic target for this disease. Shengkui Lu, Shuai Wang, Shaomei Geng, Shucheng Ma, Zhaohui Liang, and Baohua Jiao Copyright © 2012 Shengkui Lu et al. All rights reserved. Progesterone Downregulates Oestrogen-Induced Expression of CFTR and SLC26A6 Proteins and mRNA in Rats’ Uteri Sun, 11 Nov 2012 08:39:11 +0000 Under progesterone (P) dominance, fluid loss assists uterine closure which is associated with pH reduction. We hypothesize that P inhibits uterine fluid secretion and transport. Aim. to investigate the expression of Cystic Fibrosis Transmembrane Regulator (CFTR) and Cl−/ exchanger (SLC26A6) under P effect. Method. Uteri from ovariectomized steroid replaced and intact rats at different stages of oestrous cycle were analyzed for changes in protein and mRNA expressions. Results. P inhibits CFTR and SLC26A6 proteins and mRNA expression while oestrogen (E) causes vice versa. E treatment followed by P causes a reduction in these transporters’ mRNA and protein. Similar changes occur throughout the oestrous cycle; that is, CFTR mRNA expression was high at proestrus while SLC26A6 mRNA and protein expressions were increased at proestrus and estrus. At diestrus, however, the expression of these transporters’ protein and mRNA was reduced. Conclusion. Inhibition of CFTR and SLC26A6 expressions may explain the reduced fluid volume and pH under P-mediated effect. K. Gholami, S. Muniandy, and N. Salleh Copyright © 2012 K. Gholami et al. All rights reserved. Molecular Mechanisms Involved in Inflammation and Insulin Resistance in Chronic Diseases and Possible Interventions Tue, 25 Sep 2012 17:48:44 +0000 Renata Gorjão, Hilton Kenji Takahashi, Ji An Pan, and Sandro Massao Hirabara Copyright © 2012 Renata Gorjão et al. All rights reserved. Molecular Targets Related to Inflammation and Insulin Resistance and Potential Interventions Tue, 25 Sep 2012 11:07:04 +0000 Inflammation and insulin resistance are common in several chronic diseases, such as obesity, type 2 diabetes mellitus, metabolic syndrome, cancer, and cardiovascular diseases. Various studies show a relationship between these two factors, although the mechanisms involved are not completely understood yet. Here, we discuss the molecular basis of insulin resistance and inflammation and the molecular aspects on inflammatory pathways interfering in insulin action. Moreover, we explore interventions based on molecular targets for preventing or treating correlated disorders, advances for a better characterization, and understanding of the mechanisms and mediators involved in the different inflammatory and insulin resistance conditions. Finally, we address biotechnological studies for the development of new potential therapies and interventions. Sandro M. Hirabara, Renata Gorjão, Marco A. Vinolo, Alice C. Rodrigues, Renato T. Nachbar, and Rui Curi Copyright © 2012 Sandro M. Hirabara et al. All rights reserved. The Immunologic Injury Composite with Balloon Injury Leads to Dyslipidemia: A Robust Rabbit Model of Human Atherosclerosis and Vulnerable Plaque Tue, 04 Sep 2012 08:30:12 +0000 Atherosclerosis is a condition in which a lipid deposition, thrombus formation, immune cell infiltration, and a chronic inflammatory response, but its systemic study has been hampered by the lack of suitable animal models, especially in herbalism fields. We have tried to perform a perfect animal model that completely replicates the stages of human atherosclerosis. This is the first combined study about the immunologic injury and balloon injury based on the cholesterol diet. In this study, we developed a modified protocol of the white rabbit model that could represent a novel approach to studying human atherosclerosis and vulnerable plaque. Guangyin Zhang, Ming Li, Liangjun Li, Yingzhi Xu, Peng Li, Cui Yang, Yanan Zhou, and Junping Zhang Copyright © 2012 Guangyin Zhang et al. All rights reserved. Sunflower Oil Supplementation Has Proinflammatory Effects and Does Not Reverse Insulin Resistance in Obesity Induced by High-Fat Diet in C57BL/6 Mice Mon, 03 Sep 2012 13:24:32 +0000 High consumption of polyunsaturated fatty acids, such as sunflower oil has been associated to beneficial effects in plasma lipid profile, but its role on inflammation and insulin resistance is not fully elucidated yet. We evaluated the effect of sunflower oil supplementation on inflammatory state and insulin resistance condition in HFD-induced obese mice. C57BL/6 male mice (8 weeks) were divided in four groups: (a) control diet (CD), (b) HFD, (c) CD supplemented with n-6 (CD + n-6), and (d) HFD supplemented with n-6 (HFD + n-6). CD + n-6 and HFD + n-6 were supplemented with sunflower oil by oral gavage at 2 g/Kg of body weight, three times per week. CD and HFD were supplemented with water instead at the same dose. HFD induced whole and muscle-specific insulin resistance associated with increased inflammatory markers in insulin-sensitive tissues and macrophage cells. Sunflower oil supplementation was not efficient in preventing or reducing these parameters. In addition, the supplementation increased pro-inflammatory cytokine production by macrophages and tissues. Lipid profile, on the other hand, was improved with the sunflower oil supplementation in animals fed HFD. In conclusion, sunflower oil supplementation improves lipid profile, but it does not prevent or attenuate insulin resistance and inflammation induced by HFD in C57BL/6 mice. Laureane Nunes Masi, Amanda Roque Martins, José César Rosa Neto, Cátia Lira do Amaral, Amanda Rabello Crisma, Marco Aurélio Ramirez Vinolo, Edson Alves de Lima Júnior, Sandro Massao Hirabara, and Rui Curi Copyright © 2012 Laureane Nunes Masi et al. All rights reserved. Role of Vitamin D in Insulin Resistance Mon, 03 Sep 2012 11:23:55 +0000 Vitamin D is characterized as a regulator of homeostasis of bone and mineral metabolism, but it can also provide nonskeletal actions because vitamin D receptors have been found in various tissues including the brain, prostate, breast, colon, pancreas, and immune cells. Bone metabolism, modulation of the immune response, and regulation of cell proliferation and differentiation are all biological functions of vitamin D. Vitamin D may play an important role in modifying the risk of cardiometabolic outcomes, including diabetes mellitus (DM), hypertension, and cardiovascular disease. The incidence of type 2 DM is increasing worldwide and results from a lack of insulin or inadequate insulin secretion following increases in insulin resistance. Therefore, it has been proposed that vitamin D deficiency plays an important role in insulin resistance resulting in diabetes. The potential role of vitamin D deficiency in insulin resistance has been proposed to be associated with inherited gene polymorphisms including vitamin D-binding protein, vitamin D receptor, and vitamin D 1alpha-hydroxylase gene. Other roles have been proposed to involve immunoregulatory function by activating innate and adaptive immunity and cytokine release, activating inflammation by upregulation of nuclear factor κB and inducing tumor necrosis factor α, and other molecular actions to maintain glucose homeostasis and mediate insulin sensitivity by a low calcium status, obesity, or by elevating serum levels of parathyroid hormone. These effects of vitamin D deficiency, either acting in concert or alone, all serve to increase insulin resistance. Although there is evidence to support a relationship between vitamin D status and insulin resistance, the underlying mechanism requires further exploration. The purpose of this paper was to review the current information available concerning the role of vitamin D in insulin resistance. Chih-Chien Sung, Min-Tser Liao, Kuo-Cheng Lu, and Chia-Chao Wu Copyright © 2012 Chih-Chien Sung et al. All rights reserved. Maternal Moderate Physical Training during Pregnancy Attenuates the Effects of a Low-Protein Diet on the Impaired Secretion of Insulin in Rats: Potential Role for Compensation of Insulin Resistance and Preventing Gestational Diabetes Mellitus Mon, 13 Aug 2012 08:49:05 +0000 The effects of pregestational and gestational low-to-moderate physical training on insulin secretion in undernourished mothers were evaluated. Virgin female Wistar rats were divided into four groups as follows: control (C, 𝑛=5); trained (T, 𝑛=5); low-protein diet (LP, 𝑛=5); trained with a low-protein diet (T + LP, 𝑛=5). Trained rats ran on a treadmill over a period of 4 weeks before mate (5 days week−1 and 60 min day−1, at 65% of VO2max). At pregnancy, the intensity and duration of the exercise were reduced. Low-protein groups were provided with an 8% casein diet, and controls were provided with a 17% casein diet. At third day after delivery, mothers and pups were killed and islets were isolated by collagenase digestion of pancreas and incubated for a further 1 h with medium containing 5.6 or 16.7 mM glucose. T mothers showed increased insulin secretion by isolated islets incubated with 16.7 mM glucose, whereas LP group showed reduced secretion of insulin by isolated islets when compared with both C and LP + T groups. Physical training before and during pregnancy attenuated the effects of a low-protein diet on the secretion of insulin, suggesting a potential role for compensation of insulin resistance and preventing gestational diabetes mellitus. Carol Góis Leandro, Marco Fidalgo, Adriano Bento-Santos, Filippe Falcão-Tebas, Diogo Vasconcelos, Raul Manhães-de-Castro, Angelo Rafael Carpinelli, Sandro Massao Hirabara, and Rui Curi Copyright © 2012 Carol Góis Leandro et al. All rights reserved. Reactive Oxygen Species in Health and Disease Wed, 08 Aug 2012 11:13:58 +0000 During the past decades, it became obvious that reactive oxygen species (ROS) exert a multitude of biological effects covering a wide spectrum that ranges from physiological regulatory functions to damaging alterations participating in the pathogenesis of increasing number of diseases. This review summarizes the key roles played by the ROS in both health and disease. ROS are metabolic products arising from various cells; two cellular organelles are intimately involved in their production and metabolism, namely, the endoplasmic reticulum and the mitochondria. Updates on research that tremendously aided in confirming the fundamental roles of both organelles in redox regulation will be discussed as well. Although not comprehensive, this review will provide brief perspective on some of the current research conducted in this area for better understanding of the ROS actions in various conditions of health and disease. Assim A. Alfadda and Reem M. Sallam Copyright © 2012 Assim A. Alfadda and Reem M. Sallam. All rights reserved. Insulin Resistance in Patients with Chronic Kidney Disease Tue, 07 Aug 2012 13:08:23 +0000 Metabolic syndrome and its components are associated with chronic kidney disease (CKD) development. Insulin resistance (IR) plays a central role in the metabolic syndrome and is associated with increased risk for CKD in nondiabetic patients. IR is common in patients with mild-to-moderate stage CKD, even when the glomerular filtration rate is within the normal range. IR, along with oxidative stress and inflammation, also promotes kidney disease. In patients with end stage renal disease, IR is an independent predictor of cardiovascular disease and is linked to protein energy wasting and malnutrition. Systemic inflammation, oxidative stress, elevated serum adipokines and fetuin-A, metabolic acidosis, vitamin D deficiency, depressed serum erythropoietin, endoplasmic reticulum stress, and suppressors of cytokine signaling all cause IR by suppressing insulin receptor-PI3K-Akt pathways in CKD. In addition to adequate renal replacement therapy and correction of uremia-associated factors, thiazolidinedione, ghrelin, protein restriction, and keto-acid supplementation are therapeutic options. Weight control, reduced daily prednisolone dosage, and the use of cyclosporin decrease the risk of developing new-onset diabetes after kidney transplantation. Improved understanding of the pathogenic mechanisms underlying IR in CKD may lead to more effective therapeutic strategies to reduce uremia-associated morbidity and mortality. Min-Tser Liao, Chih-Chien Sung, Kuo-Chin Hung, Chia-Chao Wu, Lan Lo, and Kuo-Cheng Lu Copyright © 2012 Min-Tser Liao et al. All rights reserved. Treatment with Aqueous Extract from Croton cajucara Benth Reduces Hepatic Oxidative Stress in Streptozotocin-Diabetic Rats Mon, 02 Jul 2012 11:29:42 +0000 Croton cajucara Benth is a plant found in Amazonia, Brazil and the bark and leaf infusion of this plant have been popularly used to treat diabetes and hepatic disorders. The present study was designed to evaluate the oxidative stress as well as the therapeutic effect of Croton cajucara Benth (1.5 mL of the C. cajucara extract i.g.) in rats with streptozotocin-induced diabetes. Croton cajucara Benth was tested as an aqueous extract for its phytochemical composition, and its antioxidant activity in vitro was also evaluated. Lipid peroxidation and superoxide dismutase, catalase, and glutathione reductase activities were measured in the hepatic tissue, as well as the presence activation of p65 (NF-κB), through western blot. Phytochemical screening of Croton cajucara Benth detected the presence of flavonoids, coumarins and alkaloids. The extract exhibited a significant antioxidant activity in the DPPH-scavenging and the hypoxanthine/xanthine oxidase assays. Liver lipid peroxidation increased in diabetic animals followed by a reduction in the Croton-cajucara-Benth-treated group. There was activation of p65 nuclear expression in the diabetic animals, which was attenuated in the animals receiving the Croton cajucara Benth aqueous extract. The liver tissue in diabetic rats showed oxidative alterations related to the streptozotocin treatment. In conclusion the Croton cajucara Benth aqueus extract treatment effectively reduced the oxidative stress and contributed to tissue recovery. Graziella Ramos Rodrigues, Fábio Cangeri Di Naso, Marilene Porawski, Éder Marcolin, Nélson Alexandre Kretzmann, Alexandre de Barros Falcão Ferraz, Marc Francois Richter, Cláudio Augusto Marroni, and Norma Possa Marroni Copyright © 2012 Graziella Ramos Rodrigues et al. All rights reserved. Association of Polymorphisms in Mitofusin-2 Gene with Type 2 Diabetes in Han Chinese Mon, 18 Jun 2012 14:44:10 +0000 MFN2 and ESRRA are candidate genes involved in the pathogenesis of T2D. Five tag-SNPs in MFN2 gene and three in ESRRA gene were selected and genotyped with TaqMan or PCR-RFLP method in stage 1 populations (555 patients with T2D and 649 control subjects) and stage 2 populations (546 patients with T2D versus 419 control subjects) in Han Chinese. And combining our published data, we estimated the interactions between genetic variants in the MFN2, ESRRA, and PGC-1α genes on the T2D risk using MDR. rs873458 (𝐺>𝐴) and rs2878677 (𝐶>𝑇) in MFN2 gene were significantly associated with T2D (𝑃=0.005 and 0.01) in stage 1 populations, and the association of other SNPs with T2D was not found. In stage 2 populations, we further confirmed the association between rs2878677 and T2D (𝑃=0.01). Combining the two stage populations, the data supported more significant effect of rs873458 and rs2878677 on T2D risk (𝑃=0.003 and 0.0001). A-C-G-T-C and G-T-C-T-C in MFN2 had significant association with T2D (𝑃=0.007 and 0.009). The present study also provided the evidence that MFN2 had interactions with PGC-1α (𝑃<0.0001) or ESRRA (𝑃<0.0001). This study suggested a role of MFN2 polymorphism in the risk of T2D; however, further studies are needed. Pengtao Li, Shuying Zhu, Xiaopan Wu, Xilin Zhu, Jingyun Li, Liping Pan, Zhenhui Xin, Fenghe Niu, Jia Wu, and Ying Liu Copyright © 2012 Pengtao Li et al. All rights reserved. Molecular Characterization of a Fully Human Chimeric T-Cell Antigen Receptor for Tumor-Associated Antigen EpCAM Tue, 03 Apr 2012 10:11:57 +0000 The transduction of T cells to express chimeric T-cell antigen receptor (CAR) is an attractive strategy for adaptive immunotherapy for cancer, because the CAR can redirect the recognition specificity of T cells to tumor-associated antigens (TAAs) on the surface of target cells, thereby avoiding the limitations of HLA restriction. However, there are considerable problems with the clinical application of CAR, mostly due to its xenogeneic components, which could be immunogenic in humans. Moreover, while extensive studies on the CARs have been performed, the detailed molecular mechanisms underlying the activation of CAR-grafted T cells remain unclear. In order to eliminate potential immunogenicity and investigate the molecular basis of the CAR-mediated T-cell activation, we constructed a novel CAR (CAR57-28ζ) specific for one of the most important TAAs, epithelial cell adhesion molecule (EpCAM), using only human-derived genes. We revealed that in Jurkat T cells, lentivirally expressed CAR57-28ζ can transmit the T-cell-activating signals sufficient to induce IL-2 production upon EpCAM stimulation. An immunofluorescent analysis clearly showed that the CAR57-28ζ induces the formation of signaling clusters containing endogenous CD3ζ at the CAR/EpCAM interaction interface. These results suggest that this CAR gene may be safely and effectively applied for adaptive T-cell immunotherapy. Naoto Shirasu, Hiromi Yamada, Hirotomo Shibaguchi, Motomu Kuroki, and Masahide Kuroki Copyright © 2012 Naoto Shirasu et al. All rights reserved. Transcription Factor Sp1 Is Involved in Expressional Regulation of Coxsackie and Adenovirus Receptor in Cancer Cells Thu, 24 Nov 2011 18:37:12 +0000 Coxsackie and adenovirus receptor (CAR) was first known as a virus receptor. Recently, it is also known to have tumor suppressive activity such as inhibition of cell proliferation, migration, and invasion. It is important to understand how CAR expression can be regulated in cancers. Based on an existence of putative Sp1 binding site within CAR promoter, we investigated whether indeed Sp1 is involved in the regulation of CAR expression. We observed that deletion or mutation of Sp1 binding motif (−503/−498) prominently impaired the Sp1 binding affinity and activity of CAR promoter. Histone deacetylase inhibitor (TSA) treatment enhanced recruitment of Sp1 to the CAR promoter in ChIP assay. Meanwhile, Sp1 binding inhibitor suppressed the recruitment. Exogenous expression of wild-type Sp1 increased CAR expression in CAR-negative cells; meanwhile, dominant negative Sp1 decreased the CAR expression in CAR-positive cells. These results indicate that Sp1 is involved in regulation of CAR expression. Sun-Ku Chung, Joo-Young Kim, Joong-Yeon Lim, Young Mi Park, Ha-Young Hwang, Jae-Hwan Nam, and Sang Ick Park Copyright © 2011 Sun-Ku Chung et al. All rights reserved. Possible Linkage of SP6 Transcriptional Activity with Amelogenesis by Protein Stabilization Thu, 20 Oct 2011 15:09:38 +0000 Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis. Trianna W. Utami, Keiko Miyoshi, Hiroko Hagita, Ryna Dwi Yanuaryska, Taigo Horiguchi, and Takafumi Noma Copyright © 2011 Trianna W. Utami et al. All rights reserved. Expression of Recombinant Human Coagulation Factor VII by the Lizard Leishmania Expression System Thu, 08 Sep 2011 08:48:52 +0000 The variety of recombinant protein expression systems have been developed as a resource of FVII gene expression. In the current study, the authors used a novel protein expression system based on the Iranian Lizard Leishmania, a trypanosomatid protozoan as a host for expression of FVII. Plasmid containing cDNA encoding full-length human FVII was introduced into Lizard Leishmania and positive transfectants were analyzed by SDS-PAGE and Western blot analysis. Furthermore, biological activity of purified protein was detected by PT assay. The recombinant strain harboring a construct was analyzed for expression of FVII at the mRNA and protein level. Purified rFVII was obtained and in order to confirm the purified compound was in fact rFVII. Western blot analysis was carried out. Clotting time in PT assay was reduced about 30 seconds with the purified rFVII. In Conclusion, this study has demonstrated, for the first time, that Leishmania cells can be used as an expression system for producing recombinant FVII. Sina Mirzaahmadi, Golnaz Asaadi-Tehrani, Mojgan Bandehpour, Nooshin Davoudi, Leila Tahmasbi, Nahid Hosseinzadeh, Hasan Mirzahoseini, Kazem Parivar, and Bahram Kazemi Copyright © 2011 Sina Mirzaahmadi et al. All rights reserved. Development of a Single-Step Subtraction Method for Eukaryotic 18S and 28S Ribonucleic Acids Sat, 25 Jun 2011 01:47:28 +0000 The abundance of mammalian 18S and 28S ribosomal RNA can decrease the detection sensitivity of bacterial or viral targets in complex host-pathogen mixtures. A method to capture human RNA in a single step was developed and characterized to address this issue. For this purpose, capture probes were covalently attached to magnetic microbeads using a dendrimer linker and the solid phase was tested using rat thymus RNA (mammalian components) with Escherichia coli RNA (bacterial target) as a model system. Our results indicated that random capture probes demonstrated better performance than specific ones presumably by increasing the number of possible binding sites, and the use of a tetrame-thylammonium-chloride (TMA-Cl-) based buffer for the hybridization showed a beneficial effect in the selectivity. The subtraction efficiency determined through real-time RT-PCR revealed capture-efficiencies comparable with commercially available enrichment kits. The performance of the solid phase can be further fine tuned by modifying the annealing time and temperature. Marie J. Archer and Baochuan Lin Copyright © 2011 Marie J. Archer and Baochuan Lin. All rights reserved. The Epithelium—Molecular Landscaping for an Interactive Barrier Mon, 28 Mar 2011 11:43:47 +0000 Karl Chai, Kenichiro Kitamura, Amanda McCann, and Xue-Ru Wu Copyright © 2010 Karl Chai et al. All rights reserved. Biomolecular Interaction Study of Cyclolinopeptide A with Human Serum Albumin Wed, 09 Mar 2011 16:39:41 +0000 The kinetics, energetics, and structure of Cyclolinopeptide A binding with Human Serum Albumin were investigated with surface plasmon resonance and circular dichroism. The complex is formed through slow recognition kinetics that is temperature sensitive in the range of 20°C–37°C. The overall reaction was observed to be endothermic ( kJ ) and entropy driven ( J ) with overall small changes to the tertiary structure. Ben Rempel, Bo Gui, Jason Maley, Martin Reaney, and Ramaswami Sammynaiken Copyright © 2010 Ben Rempel et al. All rights reserved.