BioMed Research International: Molecular Biology http://www.hindawi.com The latest articles from Hindawi Publishing Corporation © 2014 , Hindawi Publishing Corporation . All rights reserved. Current Advances in Molecular Phylogenetics Mon, 07 Apr 2014 09:37:53 +0000 http://www.hindawi.com/journals/bmri/2014/596746/ Vassily Lyubetsky, William H. Piel, and Dietmar Quandt Copyright © 2014 Vassily Lyubetsky et al. All rights reserved. Phylogenetic Analysis of Entomoparasitic Nematodes, Potential Control Agents of Flea Populations in Natural Foci of Plague Thu, 03 Apr 2014 10:58:16 +0000 http://www.hindawi.com/journals/bmri/2014/135218/ Entomoparasitic nematodes are natural control agents for many insect pests, including fleas that transmit Yersinia pestis, a causative agent of plague, in the natural foci of this extremely dangerous zoonosis. We examined the flea samples from the Volga-Ural natural focus of plague for their infestation with nematodes. Among the six flea species feeding on different rodent hosts (Citellus pygmaeus, Microtus socialis, and Allactaga major), the rate of infestation varied from 0 to 21%. The propagation rate of parasitic nematodes in the haemocoel of infected fleas was very high; in some cases, we observed up to 1,000 juveniles per flea specimen. Our study of morphology, life cycle, and rDNA sequences of these parasites revealed that they belong to three distinct species differing in the host specificity. On SSU and LSU rRNA phylogenies, these species representing three genera (Rubzovinema, Psyllotylenchus, and Spilotylenchus), constitute a monophyletic group close to Allantonema and Parasitylenchus, the type genera of the families Allantonematidae and Parasitylenchidae (Nematoda: Tylenchida). We discuss the SSU-ITS1-5.8S-LSU rDNA phylogeny of the Tylenchida with a special emphasis on the suborder Hexatylina. E. I. Koshel, V. V. Aleshin, G. A. Eroshenko, and V. V. Kutyrev Copyright © 2014 E. I. Koshel et al. All rights reserved. A New Nested Allele-Specific Multiplex Polymerase Chain Reaction Method for Haplotyping of VKORC1 Gene to Predict Warfarin Sensitivity Sun, 30 Mar 2014 12:16:06 +0000 http://www.hindawi.com/journals/bmri/2014/316310/ The vitamin K epoxide reductase complex 1 gene (VKORC1) is commonly assessed to predict warfarin sensitivity. In this study, a new nested allele-specific multiplex polymerase chain reaction (PCR) method that can simultaneously identify single nucleotide polymorphisms (SNPs) at VKORC1 381, 861, 5808, and 9041 for haplotype analysis was developed and validated. Extracted DNA was amplified in the first PCR DNA, which was optimized by investigating the effects of varying the primer concentrations, annealing temperature, magnesium chloride concentration, enzyme concentration, and the amount of DNA template. The amplification products produced from the first round of PCR were used as templates for a second PCR amplification in which both mutant and wild-type primers were added in separate PCR tubes, followed by optimization in a similar manner. The final PCR products were resolved by agarose gel electrophoresis and further analysed by using a VKORC1 genealogic tree to infer patient haplotypes. Fifty patients were identified to have H1H1, one had H1H2, one had H1H7, 31 had either H1H7 or H1H9, one had H1H9, eight had H7H7, and one had H8H9 haplotypes. This is the first method that is able to infer VKORC1 haplotypes using only conventional PCR methods. Yung An Chua, Wan Zaidah Abdullah, Zukurnai Yusof, and Siew Hua Gan Copyright © 2014 Yung An Chua et al. All rights reserved. Reconciliation of Gene and Species Trees Thu, 27 Mar 2014 06:44:11 +0000 http://www.hindawi.com/journals/bmri/2014/642089/ The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i) inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii) trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii) can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree. L. Y. Rusin, E. V. Lyubetskaya, K. Y. Gorbunov, and V. A. Lyubetsky Copyright © 2014 L. Y. Rusin et al. All rights reserved. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms Wed, 05 Mar 2014 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2014/458457/ A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. Zhiyuan Wu, Yunqing Zhang, Xinju Zhang, Xiao Xu, Zhihua Kang, Shibao Li, Chen Zhang, Bing Su, and Ming Guan Copyright © 2014 Zhiyuan Wu et al. All rights reserved. Noncoding RNAs: Emerging Players in Muscular Dystrophies Tue, 04 Mar 2014 09:46:56 +0000 http://www.hindawi.com/journals/bmri/2014/503634/ The fascinating world of noncoding RNAs has recently come to light, thanks to the development of powerful sequencing technologies, revealing a variety of RNA molecules playing important regulatory functions in most, if not all, cellular processes. Many noncoding RNAs have been implicated in regulatory networks that are determinant for skeletal muscle differentiation and disease. In this review, we outline the noncoding RNAs involved in physiological mechanisms of myogenesis and those that appear dysregulated in muscle dystrophies, also discussing their potential use as disease biomarkers and therapeutic targets. Germana Falcone, Alessandra Perfetti, Beatrice Cardinali, and Fabio Martelli Copyright © 2014 Germana Falcone et al. All rights reserved. Sex Differences in Constitutive Autophagy Thu, 27 Feb 2014 15:58:50 +0000 http://www.hindawi.com/journals/bmri/2014/652817/ Sex bias has been described nowadays in biomedical research on animal models, although sexual dimorphism has been confirmed widely under pathological and physiological conditions. The main objective of our work was to study the sex differences in constitutive autophagy in spinal cord and skeletal muscle tissue from wild type mice. To examine the influence of sex on autophagy, mRNA and proteins were extracted from male and female mice tissues. The expressions of microtubule-associated protein 1 light chain 3 (LC3) and sequestosome 1 (p62), markers to monitor autophagy, were analyzed at 40, 60, 90, and 120 days of age. We found significant sex differences in the expression of LC3 and p62 in both tissues at these ages. The results indicated that sex and tissue specific differences exist in constitutive autophagy. These data underlined the need to include both sexes in the experimental groups to minimize any sex bias. Sara Oliván, Ana Cristina Calvo, Raquel Manzano, Pilar Zaragoza, and Rosario Osta Copyright © 2014 Sara Oliván et al. All rights reserved. Role of Noncoding RNAs in the Regulation of P-TEFb Availability and Enzymatic Activity Wed, 19 Feb 2014 10:09:00 +0000 http://www.hindawi.com/journals/bmri/2014/643805/ P-TEFb is a transcriptional factor that specifically regulates the elongation step of RNA polymerase II-dependent transcription and its activity strictly required for Human Immunodeficiency Virus (HIV) infection and during cardiac differentiation. P-TEFb role has emerged as a crucial regulator of transcription elongation and its activity found finely tuned in vivo at transcriptional level as well as posttranscriptionally by dynamic association with different multisubunit molecular particles. Both physiological and pathological cellular signals rapidly converge on P-TEFb regulation by modifying expression and activity of the complex to allow cells to properly respond to different stimuli. In this review we will give a panoramic view on P-TEFb regulation by noncoding RNAs in both physiological and pathological conditions. Giuliana Napolitano, Luigi Lania, and Barbara Majello Copyright © 2014 Giuliana Napolitano et al. All rights reserved. Insulin Receptor Substrate-1 (IRS-1) Gly927Arg: Correlation with Gestational Diabetes Mellitus in Saudi Women Mon, 17 Feb 2014 12:24:40 +0000 http://www.hindawi.com/journals/bmri/2014/146495/ Pregnant women with gestational diabetes mellitus (GDM) and type 2 diabetes mellitus (T2DM) share a common pathophysiology associated with similar risk factors. Genetic variants used to determine the risk of developing T2DM might also be associated with the prevalence of GDM. The aim of the present study was to scrutinize the relationship between the G972R polymorphism of the insulin receptor substrate-1 (IRS-1) gene with GDM in the Saudi female population. This is a case-control study that monitored 500 Saudi women. Subjects with GDM () were compared with non-GDM () controls. We opted to evaluate rs1801278 polymorphism in the IRS1 gene, which plays a critical role in the insulin-signaling pathway. Genotyping was performed with the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method. The frequency of the rs1801278 polymorphism was significantly higher in women with GDM than in women with non-GDM (for TT + CT versus CC: ). Additionally, there was a significant increase in the frequency of the Arg-encoding mutant allele from GDM to non-GDM (for T versus C: ). Our results suggest that the rs1801278 polymorphism in the IRS-1 gene is involved in the occurrence of GDM in the Saudi population. Khalid Khalaf Alharbi, Imran Ali Khan, Zeinab Abotalib, and Malak Mohammed Al-Hakeem Copyright © 2014 Khalid Khalaf Alharbi et al. All rights reserved. The Role of PinX1 in Growth Control of Breast Cancer Cells and Its Potential Molecular Mechanism by mRNA and lncRNA Expression Profiles Screening Mon, 03 Feb 2014 11:13:11 +0000 http://www.hindawi.com/journals/bmri/2014/978984/ As a major tumor suppressor gene, the role of PinX1 in breast cancer and its molecular mechanism remain unclear. In this study, overexpression of PinX1 was generated in 3 breast cancer cell lines, and knockdown of PinX1 was performed in a nontumorigenic breast cell line. The regulation of PinX1 on cell proliferation and cell cycle was observed. A microarray-based lncRNA and mRNA expression profile screening was also performed. We found a lower growth rate, G0/G1 phase arrest, and S phase inhibition in the PinX1 overexpressed breast cancer cells, while a higher growth rate, decreased G0/G1 phase, and increased S phase rate in the PinX1 knocked-down nontumorigenic breast cell. A total of 977 mRNAs and 631 lncRNAs were identified as differentially expressed transcripts between PinX1 overexpressed and control MCF-7 cells. Further analysis identified the involvement of these mRNAs in 52 cancer related pathways and various other biological processes. 11 enhancer-like lncRNAs and 25 lincRNAs with their adjacent mRNA pairs were identified as coregulated transcripts. Our results confirmed the role of PinX1 as a major tumor suppressor gene in breast cancer cell lines and provided information for further research on the molecular mechanisms of PinX1 in tumorigenesis. Rong Shi, Jue-Yu Zhou, Hui Zhou, Zhen Zhao, Sang-Hua Liang, Wen-Ling Zheng, and Wen-Li Ma Copyright © 2014 Rong Shi et al. All rights reserved. Brd4 and HEXIM1: Multiple Roles in P-TEFb Regulation and Cancer Wed, 29 Jan 2014 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2014/232870/ Bromodomain-containing protein 4 (Brd4) and hexamethylene bisacetamide (HMBA) inducible protein 1 (HEXIM1) are two opposing regulators of the positive transcription elongation factor b (P-TEFb), which is the master modulator of RNA polymerase II during transcriptional elongation. While Brd4 recruits P-TEFb to promoter-proximal chromatins to activate transcription, HEXIM1 sequesters P-TEFb into an inactive complex containing the 7SK small nuclear RNA. Besides regulating P-TEFb’s transcriptional activity, recent evidence demonstrates that both Brd4 and HEXIM1 also play novel roles in cell cycle progression and tumorigenesis. Here we will discuss the current knowledge on Brd4 and HEXIM1 and their implication as novel therapeutic options against cancer. Ruichuan Chen, Jasper H. N. Yik, Qiao Jing Lew, and Sheng-Hao Chao Copyright © 2014 Ruichuan Chen et al. All rights reserved. Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species Wed, 29 Jan 2014 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2014/857329/ The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. Oksana S. Bychenko, Lyubov V. Sukhanova, Tatyana L. Azhikina, Timofey A. Skvortsov, Tuyana V. Belomestnykh, and Eugene D. Sverdlov Copyright © 2014 Oksana S. Bychenko et al. All rights reserved. Molecular Characterization of a Recombinant Manganese Superoxide Dismutase from Lactococcus lactis M4 Mon, 27 Jan 2014 12:38:58 +0000 http://www.hindawi.com/journals/bmri/2014/469298/ A superoxide dismutase (SOD) gene of Lactococcus lactis M4 was cloned and expressed in a prokaryotic system. Sequence analysis revealed an open reading frame of 621 bp which codes for 206 amino acid residues. Expression of sodA under T7 promoter exhibited a specific activity of 4967 U/mg when induced with 1 mM of isopropyl-β-D-thiogalactopyranoside. The recombinant SOD was purified to homogeneity by immobilised metal affinity chromatography and Superose 12 gel filtration chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot analyses of the recombinant SOD detected a molecular mass of approximately 27 kDa. However, the SOD was in dimer form as revealed by gel filtration chromatography. The purified recombinant enzyme had a pI of 4.5 and exhibited maximal activity at 25°C and pH 7.2. It was stable up to 45°C. The insensitivity of this lactococcal SOD to cyanide and hydrogen peroxide established that it was a MnSOD. Although it has 98% homology to SOD of L. lactis IL1403, this is the first elucidated structure of lactococcal SOD revealing active sites containing the catalytic manganese coordinated by four ligands (H-27, H-82, D-168, and H-172). Boon Hooi Tan, Thean Chor Leow, Hooi Ling Foo, and Raha Abdul Rahim Copyright © 2014 Boon Hooi Tan et al. All rights reserved. DNA Methylation Pattern in Overweight Women under an Energy-Restricted Diet Supplemented with Fish Oil Wed, 22 Jan 2014 12:50:44 +0000 http://www.hindawi.com/journals/bmri/2014/675021/ Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC). However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA) on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded. Cátia Lira do Amaral, Fermín I. Milagro, Rui Curi, and J. Alfredo Martínez Copyright © 2014 Cátia Lira do Amaral et al. All rights reserved. Erratum to “Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization” Mon, 20 Jan 2014 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2014/731017/ Saliou Niassy, Sevgan Subramanian, Sunday Ekesi, Joel L. Bargul, Jandouwe Villinger, and Nguya K. Maniania Copyright © 2014 Saliou Niassy et al. All rights reserved. Changes in Bacterial Population of Gastrointestinal Tract of Weaned Pigs Fed with Different Additives Sun, 19 Jan 2014 08:12:32 +0000 http://www.hindawi.com/journals/bmri/2014/269402/ This study aimed to provide novel insights into the gastrointestinal microbial diversity from different gastrointestinal locations in weaning piglets using PCR-restriction fragment length polymorphism (PCR-RFLP). Additionally, the effect of different feed additives was analyzed. Thirty-two piglets were fed with four different diets: a control group and three enriched diets, with avilamycin, sodium butyrate, and a plant extract mixture. Digesta samples were collected from eight different gastrointestinal segments of each animal and the bacterial population was analysed by a PCR-RFLP technique that uses 16S rDNA gene sequences. Bacterial diversity was assessed by calculating the number of bands and the Shannon-Weaver index. Dendrograms were constructed to estimate the similarity of bacterial populations. A higher bacterial diversity was detected in large intestine compared to small intestine. Among diets, the most relevant microbial diversity differences were found between sodium butyrate and plant extract mixture. Proximal jejunum, ileum, and proximal colon were identified as those segments that could be representative of microbial diversity in pig gut. Results indicate that PCR-RFLP technique allowed detecting modifications on the gastrointestinal microbial ecology in pigs fed with different additives, such as increased biodiversity by sodium butyrate in feed. Mercè Roca, Miquel Nofrarías, Natàlia Majó, Ana María Pérez de Rozas, Joaquim Segalés, Marisol Castillo, Susana María Martín-Orúe, Anna Espinal, Joan Pujols, and Ignacio Badiola Copyright © 2014 Mercè Roca et al. All rights reserved. Regulation of CDK9 Activity by Phosphorylation and Dephosphorylation Sun, 12 Jan 2014 14:00:54 +0000 http://www.hindawi.com/journals/bmri/2014/964964/ HIV-1 transcription is regulated by CDK9/cyclin T1, which, unlike a typical cell cycle-dependent kinase, is regulated by associating with 7SK small nuclear ribonuclear protein complex (snRNP). While the protein components of this complex are well studied, the mechanism of the complex formation is still not fully understood. The association of CDK9/cyclin T1 with 7SK snRNP is, in part, regulated by a reversible CDK9 phosphorylation. Here, we present a comprehensive review of the kinases and phosphatases involved in CDK9 phosphorylation and discuss their role in regulation of HIV-1 replication and potential for being targeted for drug development. We propose a novel pathway of HIV-1 transcription regulation via CDK9 Ser-90 phosphorylation by CDK2 and CDK9 Ser-175 dephosphorylation by protein phosphatase-1. Sergei Nekhai, Michael Petukhov, and Denitra Breuer Copyright © 2014 Sergei Nekhai et al. All rights reserved. Isolation and Expression Analysis of Novel Silicon Absorption Gene from Roots of Mangrove (Rhizophora apiculata) via Suppression Subtractive Hybridization Wed, 01 Jan 2014 21:41:53 +0000 http://www.hindawi.com/journals/bmri/2014/971985/ Silicon (Si) is the second most abundant element in soil after oxygen. It is not an essential element for plant growth and formation but plays an important role in increasing plant tolerance towards different kinds of abiotic and biotic stresses. The molecular mechanism of Si absorption and accumulation may differ between plants, such as monocotyledons and dicotyledons. Silicon absorption and accumulation in mangrove plants are affected indirectly by some proteins rich in serine and proline amino acids. The expression level of the genes responsible for Si absorption varies in different parts of plants. In this study, Si is mainly observed in the epidermal roots’ cell walls of mangrove plants compared to other parts. The present work was carried out to discover further information on Si stress responsive genes in Rhizophora apiculata, using the suppression subtractive hybridization technique. To construct the cDNA library, two-month-old seedlings were exposed to 0.5, 1, and 1.5 mM SiO2 for 15 hrs and for 1 to 6 days resulting in a total of 360 high quality ESTs gained. Further examination by RT-PCR and real-time qRT-PCR showed the expression of a candidate gene of serine-rich protein. Mahbod Sahebi, Mohamed M. Hanafi, Siti Nor Akmar Abdullah, Mohd Y. Rafii, Parisa Azizi, Naghmeh Nejat, and Abu Seman Idris Copyright © 2014 Mahbod Sahebi et al. All rights reserved. Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta): A New Species from South China Sea Based on Morphological Observation and rbcL Gene Sequences Analysis Mon, 23 Dec 2013 13:36:53 +0000 http://www.hindawi.com/journals/bmri/2013/560163/ Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1) thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2) cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3) the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81–108 bp from the sequences of other samples in Grateloupia; there are 114–133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia. Ling Yu, Hongwei Wang, and Rixiao Luan Copyright © 2013 Ling Yu et al. All rights reserved. Overexpression of RKIP Inhibits Cell Invasion in Glioma Cell Lines through Upregulation of miR-98 Thu, 12 Dec 2013 13:40:04 +0000 http://www.hindawi.com/journals/bmri/2013/695179/ Raf-1 kinase inhibitor protein (RKIP) is a tumor and metastasis suppressor in cancer cells. MicroRNAs (miRNAs) have been suggested to play a vital role in tumor initiation and progression by negatively regulating oncogenes and tumor suppressors. Quite recently, studies have identified some miRNAs operating to promote or suppress tumor invasion or metastasis via regulating metastasis-related genes, providing potential therapeutic targets on antimetastasis strategy. In this study, we found that the expression of RKIP and miR-98 in glioma tissues were significantly lower than that in normal brain tissues. Overexpression of RKIP upregulated miR-98 expression and inhibited glioma cell invasion and miR-98 target gene HMGA2 but had no effect in glioma cell proliferation. Moreover, forced expression of miR-98 accelerated the inhibition of glioma cell invasion and the expression of HMGA2 also had no effect in glioma cell proliferation. Our findings newly described RKIP/miR-98 to HMGA2 link and provided a potential mechanism for glioma cell invasion. RKIP and miR-98 may illustrate the potential therapeutic utility of signaling pathway signatures. Zigui Chen, Quan Cheng, Zhiming Ma, Haipeng Xi, Renjun Peng, and Bing Jiang Copyright © 2013 Zigui Chen et al. All rights reserved. Algorithms of Ancestral Gene Length Reconstruction Tue, 26 Nov 2013 14:59:15 +0000 http://www.hindawi.com/journals/bmri/2013/472163/ Ancestral sequence reconstruction is a well-known problem in molecular evolution. The problem presented in this study is inspired by sequence reconstruction, but instead of leaf-associated sequences we consider only their lengths. We call this problem ancestral gene length reconstruction. It is a problem of finding an optimal labeling which minimizes the total length’s sum of the edges, where both a tree and nonnegative integers associated with corresponding leaves of the tree are the input. In this paper we give a linear algorithm to solve the problem on binary trees for the Manhattan cost function . Alexander Bolshoy and Valery M. Kirzhner Copyright © 2013 Alexander Bolshoy and Valery M. Kirzhner. All rights reserved. The Continuing Debate on Deep Molluscan Phylogeny: Evidence for Serialia (Mollusca, Monoplacophora + Polyplacophora) Thu, 21 Nov 2013 17:46:14 +0000 http://www.hindawi.com/journals/bmri/2013/407072/ Molluscs are a diverse animal phylum with a formidable fossil record. Although there is little doubt about the monophyly of the eight extant classes, relationships between these groups are controversial. We analysed a comprehensive multilocus molecular data set for molluscs, the first to include multiple species from all classes, including five monoplacophorans in both extant families. Our analyses of five markers resolve two major clades: the first includes gastropods and bivalves sister to Serialia (monoplacophorans and chitons), and the second comprises scaphopods sister to aplacophorans and cephalopods. Traditional groupings such as Testaria, Aculifera, and Conchifera are rejected by our data with significant Approximately Unbiased (AU) test values. A new molecular clock indicates that molluscs had a terminal Precambrian origin with rapid divergence of all eight extant classes in the Cambrian. The recovery of Serialia as a derived, Late Cambrian clade is potentially in line with the stratigraphic chronology of morphologically heterogeneous early mollusc fossils. Serialia is in conflict with traditional molluscan classifications and recent phylogenomic data. Yet our hypothesis, as others from molecular data, implies frequent molluscan shell and body transformations by heterochronic shifts in development and multiple convergent adaptations, leading to the variable shells and body plans in extant lineages. I. Stöger, J. D. Sigwart, Y. Kano, T. Knebelsberger, B. A. Marshall, E. Schwabe, and M. Schrödl Copyright © 2013 I. Stöger et al. All rights reserved. Speciation in Thaparocleidus (Monogenea: Dactylogyridae) Parasitizing Asian Pangasiid Catfishes Wed, 20 Nov 2013 08:52:05 +0000 http://www.hindawi.com/journals/bmri/2013/353956/ The phylogeny of monogeneans of the genus Thaparocleidus that parasitize the gills of Pangasiidae in Borneo and Sumatra was inferred from molecular data to investigate parasite speciation. The phylogeny of the Pangasiidae was also reconstructed in order to investigate host-parasite coevolutionary history. The monophyly of Thaparocleidus parasitizing Pangasiidae was confirmed. Low intraspecies molecular variability was observed in three Thaparocleidus species collected from geographically distant localities. However, a high intraspecies molecular variability was observed in two Thaparocleidus species suggesting that these species represent a complex of species highly similar in morphology. Distance-based and tree-based methods revealed a significant global fit between parasite and host phylogenies. Parasite duplication (i.e., intrahost speciation) was recognized as the most common event in Thaparocleidus, while the numbers of cospeciation and host switches were lower and similar to each other. When collapsing nodes correspond to duplication cases, our results suggest host switches in the Thaparocleidus-Pangasiidae system precluding congruence between host and parasite trees. We found that the morphometric variability of the parasite attachment organ is not linked to phylogeny, suggesting that the attachment organ is under adaptive constraint. We showed that haptor morphometry is linked to host specificity, whereby nonspecific parasites display higher morphometric variability than specialists. Andrea Šimková, Celine Serbielle, Antoine Pariselle, Maarten P. M. Vanhove, and Serge Morand Copyright © 2013 Andrea Šimková et al. All rights reserved. The Evolutionary Pattern and the Regulation of Stearoyl-CoA Desaturase Genes Thu, 07 Nov 2013 17:33:37 +0000 http://www.hindawi.com/journals/bmri/2013/856521/ Stearoyl-CoA desaturase (SCD) is a key enzyme that converts saturated fatty acids (SFAs) to monounsaturated fatty acids (MUFAs) in the biosynthesis of fat. To date, two isoforms of scd gene (scd1 and scd5) have been found widely existent in most of the vertebrate animals. However, the evolutionary patterns of both isofoms and the function of scd5 are poorly understandable. Herein, we aim to characterize the evolutionary pattern of scd genes and further predict the function differentiation of scd genes. The sequences of scd genes were highly conserved among eukaryote. Phylogenetic analysis identified two duplications of scd gene early in vertebrate evolution. The relative rate ratio test, branch-specific dN/dS ratio tests, and branch-site dN/dS ratio tests all suggested that the scd genes were evolved at a similar rate. The evolution of scd genes among eukaryote was under strictly purifying selection though several sites in scd1 and scd5 were undergone a relaxed selection pressure. The variable binding sites by transcriptional factors at the 5′-UTR and by miRNAs at 3′-UTR of scd genes suggested that the regulators of scd5 may be different from that of scd1. This study promotes our understanding of the evolutionary patterns and function of SCD genes in eukaryote. Xiaoyun Wu, Xiaoju Zou, Qing Chang, Yuru Zhang, Yunhai Li, Linqiang Zhang, Jingfei Huang, and Bin Liang Copyright © 2013 Xiaoyun Wu et al. All rights reserved. Study on Characteristics of Chemokine CXCL10 Gene Cloned from cDNA Expression Library of Ujumqin Sheep Sat, 28 Sep 2013 12:18:35 +0000 http://www.hindawi.com/journals/bmri/2013/217942/ Chemokines were a major regulator of body’s inflammatory and immune responses. In this study, the cDNA fragment of chemokine CXC ligand 10 (CXCL10) was cloned from the Ujumqin sheep ear marginal tissue cDNA expression library; the CXCL10 gene had 103 amino acids and a molecular weight of 11.47 kDa, and it shared a high homology among cattle, sheep, and goat, while a low homology compared with mouse. The CXCL10 protein had 4 conservative cysteine residues, located in 28, 30, 55, and 72 sites. The expression pattern and intracellular distribution of recombinant CXCL10 proteins in Ujumqin sheep fibroblast cells showed that there were green fluorescence signals both in cytoplasm and nucleolus after 24 h of transfection, the number of positive cells was increased with time, the peak level of fluorescence signal was reached after 48 h of transfection and the transfection efficiency was 33.3%; there was a significant decrease in fluorescence intensity after 72 h of transfection. Expression of recombinant CXCL10 gene in Escherichia coli had a time- and temperature-dependency on the amount of protein expression, and a small quantity of inducer was needed. P. F. Hu, X. C. Li, N. Lei, X. Y. Lan, Q. J. Zhao, W. J. Guan, and Y. H. Ma Copyright © 2013 P. F. Hu et al. All rights reserved. Adaptation or Malignant Transformation: The Two Faces of Epigenetically Mediated Response to Stress Thu, 26 Sep 2013 09:00:25 +0000 http://www.hindawi.com/journals/bmri/2013/954060/ Adaptive response to stress is a fundamental property of living systems. At the cellular level, many different types of stress elicit an essentially limited repertoire of adaptive responses. Epigenetic changes are the main mechanism for medium- to long-term adaptation to accumulated (intense, long-term, or repeated) stress. We propose the adaptive deregulation of the epigenome in response to stress (ADERS) hypothesis which assumes that the unspecific adaptive stress response grows stronger with the increasing stress level, epigenetically activating response gene clusters while progressively deregulating other cellular processes. The balance between the unspecific adaptive response and the general epigenetic deregulation is critical because a strong response can lead to pathology, particularly to malignant transformation. The main idea of our hypothesis is the continuum traversed by a cell subjected to accumulated stress, which lies between an unspecific adaptive response and pathological deregulation—the two extremes sharing the same underlying cause, which is a manifestation of a unified epigenetically mediated adaptive response to stress. The evolutionary potential of epigenetic regulation in multigenerational adaptation is speculatively discussed in the light of neo-Lamarckism. Finally, an approach to testing the proposed hypothesis is presented, relying on either the publicly available datasets or on conducting new experiments. Aleksandar Vojta and Vlatka Zoldoš Copyright © 2013 Aleksandar Vojta and Vlatka Zoldoš. All rights reserved. Molecular and Immunogenic Properties of Apyrase SP01B and D7-Related SP04 Recombinant Salivary Proteins of Phlebotomus perniciosus from Madrid, Spain Sun, 22 Sep 2013 14:08:56 +0000 http://www.hindawi.com/journals/bmri/2013/526069/ Sand fly salivary proteins are on the spotlight to become vaccine candidates against leishmaniasis and to markers of exposure to sand fly bites due to the host immune responses they elicit. Working with the whole salivary homogenate entails serious drawbacks such as the need for maintaining sand fly colonies and the laborious task of glands dissection. In order to overcome these difficulties, producing recombinant proteins of different vectors has become a major task. In this study, a cDNA library was constructed with the salivary glands of Phlebotomus perniciosus from Madrid, Spain, the most widespread vector of Leishmania infantum in the Mediterranean basin. Analysis of the cDNA sequences showed several polymorphisms among the previously described salivary transcripts. The apyrase SP01B and the D7-related protein SP04 were successfully cloned, expressed in Escherichia coli, and purified. Besides, recombinant proteins were recognized by sera of hamsters and mice previously immunized with saliva through the exposure to uninfected sand fly bites. These results suggest that these two recombinant proteins conserved their immunogenic properties after expression in a prokaryote system. Therefore, this work contributes to expand the knowledge of P. perniciosus saliva that would be eventually used for the development of tools for vector control programs. Inés Martín-Martín, Ricardo Molina, and Maribel Jiménez Copyright © 2013 Inés Martín-Martín et al. All rights reserved. In-Vivo Effect of Andrographolide on Alveolar Bone Resorption Induced by Porphyromonas gingivalis and Its Relation with Antioxidant Enzymes Tue, 17 Sep 2013 09:20:14 +0000 http://www.hindawi.com/journals/bmri/2013/276329/ Alveolar bone resorption is one of the most important facts in denture construction. Porphyromonas gingivalis (Pg) causes alveolar bone resorption, and morphologic measurements are the most frequent methods to identify bone resorption in periodontal studies. This study has aimed at evaluating the effect of Andrographolide (AND) on alveolar bone resorption in rats induced by Pg. 24 healthy male Sprague Dawley rats were divided into four groups as follows: normal control group and three experimental groups challenged orally with Pg ATCC 33277 five times a week supplemented with 20 mg/kg and 10 mg/kg of AND for twelve weeks. Alveolar bones of the left and right sides of the mandible were assessed by a morphometric method. The bone level, that is, the distance from the alveolar bone crest to cementumenamel junction (CEJ), was measured using 6.1 : 1 zoom stereomicroscope and software. AND reduced the effect of Pg on alveolar bone resorption and decreased the serum levels of Hexanoyl-Lysine (HEL); furthermore the reduced glutathione/oxidised glutathione (GSH/GSSG) ratio in AND treated groups (10 and 20 mg/kg) significantly increased when compared with the Pg group . We can conclude that AND suppresses alveolar bone resorption caused by Pg in rats. Rami Al Batran, Fouad H. Al-Bayaty, and Mazen M. Jamil Al-Obaidi Copyright © 2013 Rami Al Batran et al. All rights reserved. Recombinant Rat CC10 Protein Inhibits PDGF-Induced Airway Smooth Muscle Cells Proliferation and Migration Wed, 11 Sep 2013 15:05:14 +0000 http://www.hindawi.com/journals/bmri/2013/690937/ Abnormal migration and proliferation of airway smooth muscle cells (ASMCs) in the airway cause airway wall thickening, which is strongly related with the development of airway remodeling in asthma. Clara cell 10 kDa protein (CC10), which is secreted by the epithelial clara cells of the pulmonary airways, plays an important role in the regulation of immunological and inflammatory processes. Previous studies suggested that CC10 protein had great protective effects against inflammation in asthma. However, the effects of CC10 protein on ASMCs migration and proliferation in airway remodeling were poorly understood. In this study, we constructed the pET-22b-CC10 recombinant plasmid, induced expression and purified the recombinant rat CC10 protein from E. coli by Ni2+ affinity chromatography and ion exchange chromatography purification. We investigated the effect of recombinant rat CC10 protein on platelet-derived growth factor (PDGF)-BB-induced ASMCs proliferation and migration. Our results demonstrated that the recombinant CC10 protein could inhibit PDGF-BB-induced cell viability, proliferation and migration. Western blot analysis showed that PDGF-BB-induced activation of cyclin D1 was inhibited by CC10. These findings implicated that CC10 could inhibit increased ASMCs proliferation, and migration induced by PDGF-BB, and this suppression effect might be associated with inhibition of cyclin D1 expression, which might offer hope for the future treatment of airway remodeling. Ying Wei, Yu-Dong Xu, Lei-Miao Yin, Yu Wang, Jun Ran, Qi Liu, Zi-Feng Ma, Yan-Yan Liu, and Yong-Qing Yang Copyright © 2013 Ying Wei et al. All rights reserved. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae) Inferred from Multiple Nuclear Gene Sequences Tue, 10 Sep 2013 08:46:35 +0000 http://www.hindawi.com/journals/bmri/2013/347242/ Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae) have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1), recombination activating gene 2 (rag2), and early growth response 1 gene (egr1), from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia. Keun-Yong Kim, Myeong-Hun Ko, Huanzhang Liu, Qiongying Tang, Xianglin Chen, Jun-Ichi Miyazaki, and In-Chul Bang Copyright © 2013 Keun-Yong Kim et al. All rights reserved. Evolutionary Relations of Hexanchiformes Deep-Sea Sharks Elucidated by Whole Mitochondrial Genome Sequences Thu, 05 Sep 2013 17:40:14 +0000 http://www.hindawi.com/journals/bmri/2013/147064/ Hexanchiformes is regarded as a monophyletic taxon, but the morphological and genetic relationships between the five extant species within the order are still uncertain. In this study, we determined the whole mitochondrial DNA (mtDNA) sequences of seven sharks including representatives of the five Hexanchiformes, one squaliform, and one carcharhiniform and inferred the phylogenetic relationships among those species and 12 other Chondrichthyes (cartilaginous fishes) species for which the complete mitogenome is available. The monophyly of Hexanchiformes and its close relation with all other Squaliformes sharks were strongly supported by likelihood and Bayesian phylogenetic analysis of 13,749 aligned nucleotides of 13 protein coding genes and two rRNA genes that were derived from the whole mDNA sequences of the 19 species. The phylogeny suggested that Hexanchiformes is in the superorder Squalomorphi, Chlamydoselachus anguineus (frilled shark) is the sister species to all other Hexanchiformes, and the relations within Hexanchiformes are well resolved as Chlamydoselachus, (Notorynchus, (Heptranchias, (Hexanchus griseus, H. nakamurai))). Based on our phylogeny, we discussed evolutionary scenarios of the jaw suspension mechanism and gill slit numbers that are significant features in the sharks. Keiko Tanaka, Takashi Shiina, Taketeru Tomita, Shingo Suzuki, Kazuyoshi Hosomichi, Kazumi Sano, Hiroyuki Doi, Azumi Kono, Tomoyoshi Komiyama, Hidetoshi Inoko, Jerzy K. Kulski, and Sho Tanaka Copyright © 2013 Keiko Tanaka et al. All rights reserved. Dynamic of Mutational Events in Variable Number Tandem Repeats of Escherichia coli O157:H7 Thu, 05 Sep 2013 08:37:38 +0000 http://www.hindawi.com/journals/bmri/2013/390354/ VNTRs regions have been successfully used for bacterial subtyping; however, the hypervariability in VNTR loci is problematic when trying to predict the relationships among isolates. Since few studies have examined the mutation rate of these markers, our aim was to estimate mutation rates of VNTRs specific for verotoxigenic E. coli O157:H7. The knowledge of VNTR mutational rates and the factors affecting them would make MLVA more effective for epidemiological or microbial forensic investigations. For this purpose, we analyzed nine loci performing parallel, serial passage experiments (PSPEs) on 9 O157:H7 strains. The combined 9 PSPE population rates for the 8 mutating loci ranged from 4.4 × 10−05 to 1.8 × 10−03 mutations/generation, and the combined 8-loci mutation rate was of 2.5 × 10−03 mutations/generation. Mutations involved complete repeat units, with only one point mutation detected. A similar proportion between single and multiple repeat changes was detected. Of the 56 repeat mutations, 59% were insertions and 41% were deletions, and 72% of the mutation events corresponded to O157-10 locus. For alleles with up to 13 UR, a constant and low mutation rate was observed; meanwhile longer alleles were associated with higher and variable mutation rates. Our results are useful to interpret data from microevolution and population epidemiology studies and particularly point out that the inclusion or not of O157-10 locus or, alternatively, a differential weighting data according to the mutation rates of loci must be evaluated in relation with the objectives of the proposed study. A. V. Bustamante, A. M. Sanso, D. O. Segura, A. E. Parma, and P. M. A. Lucchesi Copyright © 2013 A. V. Bustamante et al. All rights reserved. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas Tue, 03 Sep 2013 11:36:33 +0000 http://www.hindawi.com/journals/bmri/2013/756302/ The epithelial membrane protein 3 (EMP3) is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors. Marta Mellai, Angela Piazzi, Valentina Caldera, Laura Annovazzi, Oriana Monzeglio, Rebecca Senetta, Paola Cassoni, and Davide Schiffer Copyright © 2013 Marta Mellai et al. All rights reserved. Common Variant of FTO Gene, rs9939609, and Obesity in Pakistani Females Mon, 02 Sep 2013 14:48:02 +0000 http://www.hindawi.com/journals/bmri/2013/324093/ Numerous studies confirmed the association of FTO (fat mass and obesity associated gene) common variant, rs9939609, with obesity in European populations. However, studies in Asian populations revealed conflicting results. We examined the association of rs9939609 variant of FTO gene with obesity and obesity-related anthropometric and metabolic parameters in Pakistani population. Body weight, height, waist circumference, hip circumference, and blood pressure (BP) were measured. BMI and waist-to-hip ratio (WHR) were calculated. Levels of fasting blood glucose (FBG), insulin, leptin, and leptin receptors were measured by enzyme linked immunosorbent assay (ELISA), and homeostasis model assessment of insulin resistance (HOMA-IR) was calculated. The results showed association of FTO gene, rs9939609, with obesity in females (>18 years of age). FTO minor allele increased the risk of obesity by 2.8 times (95% CI = 1.3–6.0) in females. This allele showed association with body weight, BMI, waist circumference, hip circumference, WHR, BP, plasma FBG levels, HOMA-IR, plasma insulin levels, and plasma leptin levels. In conclusion, FTO gene, rs9939609, is associated with BMI and risk of obesity in adult Pakistani females. Association of rs9939609 variant with higher FBG, plasma insulin, and leptin levels indicates that this polymorphism may disturb the metabolism in adult females and predispose them to obesity and type 2 diabetes. However, the above-mentioned findings were not seen in children or males. Adeela Shahid, Sobia Rana, Shahid Saeed, Muhammad Imran, Nasir Afzal, and Saqib Mahmood Copyright © 2013 Adeela Shahid et al. All rights reserved. Transcription Regulation of Plastid Genes Involved in Sulfate Transport in Viridiplantae Thu, 29 Aug 2013 11:32:41 +0000 http://www.hindawi.com/journals/bmri/2013/413450/ This study considers transcription regulation of plastid genes involved in sulfate transport in the parasites of invertebrate (Helicosporidium sp.) and other species of the Viridiplantae. A one-box conserved motif with the consensus TAAWATGATT is found near promoters upstream the cysT and cysA genes in many species. In certain cases, the motif is repeated two or three times. Vassily A. Lyubetsky, Alexander V. Seliverstov, and Oleg A. Zverkov Copyright © 2013 Vassily A. Lyubetsky et al. All rights reserved. Inferring Phylogenetic Networks from Gene Order Data Wed, 28 Aug 2013 15:05:02 +0000 http://www.hindawi.com/journals/bmri/2013/503193/ Existing algorithms allow us to infer phylogenetic networks from sequences (DNA, protein or binary), sets of trees, and distance matrices, but there are no methods to build them using the gene order data as an input. Here we describe several methods to build split networks from the gene order data, perform simulation studies, and use our methods for analyzing and interpreting different real gene order datasets. All proposed methods are based on intermediate data, which can be generated from genome structures under study and used as an input for network construction algorithms. Three intermediates are used: set of jackknife trees, distance matrix, and binary encoding. According to simulations and case studies, the best intermediates are jackknife trees and distance matrix (when used with Neighbor-Net algorithm). Binary encoding can also be useful, but only when the methods mentioned above cannot be used. Alexey Anatolievich Morozov, Yuri Pavlovich Galachyants, and Yelena Valentinovna Likhoshway Copyright © 2013 Alexey Anatolievich Morozov et al. All rights reserved. Combinatorial Control of Gene Expression Tue, 27 Aug 2013 08:55:09 +0000 http://www.hindawi.com/journals/bmri/2013/407263/ The complexity and diversity of eukaryotic organisms are a feat of nature’s engineering. Pulling the strings of such an intricate machinery requires an even more masterful and crafty approach. Only the number and type of responses that they generate exceed the staggering proportions of environmental signals perceived and processed by eukaryotes. Hence, at first glance, the cell’s sparse stockpile of controlling factors does not seem remotely adequate to carry out this response. The question as to how eukaryotes sense and respond to environmental cues has no single answer. It is an amalgamation, an interplay between several processes, pathways, and factors—a combinatorial control. A short description of some of the most important elements that operate this entire conglomerate is given in this paper. Soumya Bhattacharjee, Kaushik Renganaath, Rajesh Mehrotra, and Sandhya Mehrotra Copyright © 2013 Soumya Bhattacharjee et al. All rights reserved. Comparative Analysis of Context-Dependent Mutagenesis Using Human and Mouse Models Thu, 22 Aug 2013 12:10:38 +0000 http://www.hindawi.com/journals/bmri/2013/989410/ Substitution rates strongly depend on their nucleotide context. One of the most studied examples is the excess of C > T mutations in the CG context in various groups of organisms, including vertebrates. Studies on the molecular mechanisms underlying this mutation regularity have provided insights into evolution, mutagenesis, and cancer development. Recently several other hypermutable motifs were identified in the human genome. There is an increased frequency of T > C mutations in the second position of the words ATTG and ATAG and an increased frequency of A > C mutations in the first position of the word ACAA. For a better understanding of evolution, it is of interest whether these mutation regularities are human specific or present in other vertebrates, as their presence might affect the validity of currently used substitution models and molecular clocks. A comprehensive analysis of mutagenesis in 4 bp mutation contexts requires a vast amount of mutation data. Such data may be derived from the comparisons of individual genomes or from single nucleotide polymorphism (SNP) databases. Using this approach, we performed a systematical comparison of mutation regularities within 2–4 bp contexts in Mus musculus and Homo sapiens and uncovered that even closely related organisms may have notable differences in context-dependent mutation regularities. Sofya A. Medvedeva, Alexander Y. Panchin, Andrey V. Alexeevski, Sergey A. Spirin, and Yuri V. Panchin Copyright © 2013 Sofya A. Medvedeva et al. All rights reserved. Effect of Mesenchymal Stem Cells and a Novel Curcumin Derivative on Notch1 Signaling in Hepatoma Cell Line Mon, 19 Aug 2013 11:38:15 +0000 http://www.hindawi.com/journals/bmri/2013/129629/ This study was conducted to evaluate the effect of mesenchymal stem cells (MSCs) and a novel curcumin derivative (NCD) on HepG2 cells (hepatoma cell line) and to investigate their effect on Notch1 signaling pathway target genes. HepG2 cells were divided into HepG2 control group, HepG2 cells treated with MSC conditioned medium (MSCs CM), HepG2 cells treated with a NCD, HepG2 cells treated with MSCs CM and NCD, and HepG2 cells treated with MSCs CM (CM of MSCs pretreated with a NCD). Expression of Notch1, Hes1, VEGF, and cyclin D1 was assessed by real-time, reverse transcription-polymerase chain reaction (RT-PCR) in HepG2 cells. In addition, HepG2 proliferation assay was performed in all groups. Notch1 and its target genes (Hes1 and cyclin D1) were downregulated in all treated groups with more suppressive effect in the groups treated with both MSCs and NCD. Also, treated HepG2 cells showed significant decrease in cell proliferation rate. These data suggest that modulation of Notch1 signaling pathway by MSCs and/or NCD can be considered as a therapeutic target in HCC. Mohamed Talaat Abdel Aziz, Hussien Mostafa Khaled, Ali El Hindawi, Nagwa Kamal Roshdy, Laila A. Rashed, Dina Sabry, Amira A. Hassouna, Fatma Taha, and Walaa Ibrahim Ali Copyright © 2013 Mohamed Talaat Abdel Aziz et al. All rights reserved. A Comparison of the Biological Features of Prostate Cancer with (PSA+, PSMA+) Profile according to RKIP Wed, 07 Aug 2013 14:06:27 +0000 http://www.hindawi.com/journals/bmri/2013/409179/ Purpose. To investigate differences in the biological features of the most immunoexpressed prostate cancer (PC) profiles (PSA+, PSMA+) according to the RKIP. Methods. 19 PC with dominant Gleason grade ≥8 were studied. Expression of PSA, PSMA, RKIP, Raf-1, MEK-1, ERK-1, ERK-2, p-Akt (T308), p-Akt (S473), NF-κB p50, and NF-κBp65 were detected immunohistochemically. Results. Loss of RKIP in the most immunoexpressed PC (PSA+, PSMA+) profile was associated with increased levels of PSA and PSMA expression. Intensities of immunoreactions to PSA and PSMA were higher in cancer cells negative for RKIP (12.51 ± 1.6 and 34.95 ± 1.92) compared to those positive for RKIP (4.68 ± 1.11 and 28.56 ± 0.91). In parallel, missing RKIP expression in PC patients with PSA+, PSMA+ profile was connected with increased components of both Raf-1/MEK/ERK and NF-κB (p65/p50), whereas Akt is activated independently of RKIP. Conclusions. Although characterized by the same (PSA+, PSMA+) profile, PC phenotype missing the RKIP related to invasive potential and greater biological aggressiveness reflected in overexpression of components of Raf-1/MEK/ERK and NF-κB (p65/p50) in which Akt is activated independently of RKIP. Taking into account the PC phenotypes according to RKIP among PSA-PSMA profiles may improve distinguishing them from cancers that will become more aggressive and therefore adapt the therapeutic strategies in those patients. Awatef Ben Jemaa, Yosra Bouraoui, Sataa Sallami, Yassine Nouira, and Ridha Oueslati Copyright © 2013 Awatef Ben Jemaa et al. All rights reserved. Functions of Heterogeneous Nuclear Ribonucleoproteins in Stem Cell Potency and Differentiation Mon, 29 Jul 2013 13:38:45 +0000 http://www.hindawi.com/journals/bmri/2013/623978/ Stem cells possess huge importance in developmental biology, disease modelling, cell replacement therapy, and tissue engineering in regenerative medicine because they have the remarkable potential for self-renewal and to differentiate into almost all the cell types in the human body. Elucidation of molecular mechanisms regulating stem cell potency and differentiation is essential and critical for extensive application. Heterogeneous nuclear ribonucleoproteins (hnRNPs) are modular proteins consisting of RNA-binding motifs and auxiliary domains characterized by extensive and divergent functions in nucleic acid metabolism. Multiple roles of hnRNPs in transcriptional and posttranscriptional regulation enable them to be effective gene expression regulators. More recent findings show that hnRNP proteins are crucial factors implicated in maintenance of stem cell self-renewal and pluripotency and cell differentiation. The hnRNPs interact with certain sequences in target gene promoter regions to initiate transcription. In addition, they recognize 3′UTR or 5′UTR of specific gene mRNA forming mRNP complex to regulate mRNA stability and translation. Both of these regulatory pathways lead to modulation of gene expression that is associated with stem cell proliferation, cell cycle control, pluripotency, and committed differentiation. Qishan Chen, Min Jin, Jianhua Zhu, Qingzhong Xiao, and Li Zhang Copyright © 2013 Qishan Chen et al. All rights reserved. DHA Inhibits Protein Degradation More Efficiently than EPA by Regulating the PPAR/NFB Pathway in C2C12 Myotubes Sun, 28 Jul 2013 12:10:57 +0000 http://www.hindawi.com/journals/bmri/2013/318981/ This study was conducted to evaluate the mechanism by which n-3 PUFA regulated the protein degradation in C2C12 myotubes. Compared with the BSA control, EPA at concentrations from 400 to 600 µM decreased total protein degradation (). However, the total protein degradation was decreased when the concentrations of DHA ranged from 300 µM to 700 µM (). DHA (400 µM, 24 h) more efficiently decreased the IκBα phosphorylation and increased in the IκBα protein level than 400 µM EPA (). Compared with BSA, 400 µM EPA and DHA resulted in a 47% or 68% induction of the NFκB DNA binding activity, respectively (). Meanwhile, 400 µM EPA and DHA resulted in a 1.3-fold and 2.0-fold induction of the PPARγ expression, respectively (). In C2C12 myotubes for PPARγ knockdown, neither 400 µM EPA nor DHA affected the levels of p-IκBα, total IκBα or NFκB DNA binding activity compared with BSA (). Interestingly, EPA and DHA both still decreased the total protein degradation, although PPARγ knockdown attenuated the suppressive effects of EPA and DHA on the total protein degradation (). These results revealed that DHA inhibits protein degradation more efficiently than EPA by regulating the PPARγ/NF-κB pathway in C2C12 myotubes. Yue Wang, Qiao-wei Lin, Pei-pei Zheng, Jian-song Zhang, and Fei-ruo Huang Copyright © 2013 Yue Wang et al. All rights reserved. Bisphenol A Modifies the Regulation Exerted by Testosterone on 5α-Reductase Isozymes in Ventral Prostate of Adult Rats Thu, 25 Jul 2013 14:42:33 +0000 http://www.hindawi.com/journals/bmri/2013/629235/ The development, growth, and function of the prostate gland depend on androgen stimulation. The primary androgen in prostate is 5-dihydrotestosterone (DHT) which is synthesized from circulating testosterone (T) through the action of 5-reductase (5-R). Although 5-R occurs as five isozymes, only 5-R1 and 5-R2 are physiologically involved in steroidogenesis. The endocrine disruptor bisphenol A (BPA) alters sexual organs, including the prostate. Our previous findings indicated that BPA decreased the expression of 5-R1 and 5-R2 in rat prostate but also circulating T. Thus, it is unclear whether BPA exerts this effect on 5-R isozymes by reducing circulating T or by any other mechanism. In this study, we examine the effects of short-term exposure to BPA at doses below 25 g/Kg/d and above 300 g/Kg/d of the TDI on mRNA levels of 5-R1 and 5-R2 in prostate of adult castrated rats supplemented with T to achieve constant circulating T levels. mRNA levels were measured by absolute quantitative RT-PCR, T levels by RIA, and DHT levels by ELISA. Our results indicated that in castrated rats treated with T BPA at the two doses studied significantly decreased the mRNA levels of both 5-R isozymes in a dose-dependent manner without modifications in circulating T. Pilar Sánchez, Beatriz Castro, Jesús M. Torres, Asunción Olmo, Raimundo G. del Moral, and Esperanza Ortega Copyright © 2013 Pilar Sánchez et al. All rights reserved. Purity and Enrichment of Laser-Microdissected Midbrain Dopamine Neurons Thu, 25 Jul 2013 11:20:25 +0000 http://www.hindawi.com/journals/bmri/2013/747938/ The ability to microdissect individual cells from the nervous system has enormous potential, as it can allow for the study of gene expression in phenotypically identified cells. However, if the resultant gene expression profiles are to be accurately ascribed, it is necessary to determine the extent of contamination by nontarget cells in the microdissected sample. Here, we show that midbrain dopamine neurons can be laser-microdissected to a high degree of enrichment and purity. The average enrichment for tyrosine hydroxylase (TH) gene expression in the microdissected sample relative to midbrain sections was approximately 200-fold. For the dopamine transporter (DAT) and the vesicular monoamine transporter type 2 (Vmat2), average enrichments were approximately 100- and 60-fold, respectively. Glutamic acid decarboxylase (Gad65) expression, a marker for GABAergic neurons, was several hundredfold lower than dopamine neuron-specific genes. Glial cell and glutamatergic neuron gene expression were not detected in microdissected samples. Additionally, SN and VTA dopamine neurons had significantly different expression levels of dopamine neuron-specific genes, which likely reflects functional differences between the two cell groups. This study demonstrates that it is possible to laser-microdissect dopamine neurons to a high degree of cell purity. Therefore gene expression profiles can be precisely attributed to the targeted microdissected cells. Amanda L. Brown, Trevor A. Day, Christopher V. Dayas, and Doug W. Smith Copyright © 2013 Amanda L. Brown et al. All rights reserved. Genotype-Specific Changes in Vitamin B6 Content and the PDX Family in Potato Thu, 18 Jul 2013 10:51:17 +0000 http://www.hindawi.com/journals/bmri/2013/389723/ Vitamin B6 is one of the most versatile cofactors in plants and an essential phytonutrient in the human diet that benefits a variety of human health aspects. Although biosynthesis of the vitamin has been well resolved in recent years, the main research is currently based on Arabidopsis thaliana with very little work done on major crop plants. Here we provide the first report on interactions and expression profiles of PDX genes for vitamin B6 biosynthesis in potato and how vitamin B6 content varies in tubers of different genotypes. The results demonstrate that potato is an excellent resource for this vitamin and that strong natural variation in vitamin B6 content among the tested cultivars indicates high potential to fortify vitamin B6 nutrition in potato-based foods. Sutton Mooney, Liyuan Chen, Christina Kühn, Roy Navarre, N. Richard Knowles, and Hanjo Hellmann Copyright © 2013 Sutton Mooney et al. All rights reserved. Identification and Characterization of Cyclic AMP Response Element-Binding Protein H Response Element in the Human Apolipoprotein A5 Gene Promoter Wed, 17 Jul 2013 09:22:40 +0000 http://www.hindawi.com/journals/bmri/2013/892491/ The cyclic AMP response element-binding protein H (CREBH) plays important roles in hepatic lipogenesis, fatty acid oxidation, and lipolysis under metabolic stress. Here, we report CREBH as a novel regulator of human APOA5. Knockdown of endogenous CREBH expression via small interfering RNA resulted in the downregulation of human APOA5 mRNA expression in human hepatoma cells, HepG2. Sequence analysis suggested that putative CREBH response element (CREBHRE) is located in the human APOA5 promoter region and is highly conserved in both human and rodent. To clarify whether the human APOA5 promoter is regulated by CREBH, we analyzed the human APOA5 promoter region using a transient transfection assay and determined that transfection of CREBH induced human APOA5 promoter activity. Moreover, it was shown that CREBH directly regulated human APOA5 gene expression by binding to a unique CREBHRE located in the proximal human APOA5 promoter region, using 5′-deletion and mutagenesis of human APOA5 promoter analysis and chromatin immunoprecipitation assay. Taken together, our results demonstrated that human APOA5 is directly regulated by CREBH via CREBHRE and provided a new insight into the role of this liver-specific bZIP transcription factor in lipoprotein metabolism and triglyceride homeostasis. Kwang Hoon Song, Ah-Yeon Park, Ji-Eun Kim, and Jin Yeul Ma Copyright © 2013 Kwang Hoon Song et al. All rights reserved. miR-1279, miR-548j, miR-548m, and miR-548d-5p Binding Sites in CDSs of Paralogous and Orthologous PTPN12, MSH6, and ZEB1 Genes Tue, 16 Jul 2013 10:57:01 +0000 http://www.hindawi.com/journals/bmri/2013/902467/ Only PTPN12, MSH6, and ZEB1 have significant miR-1279 binding sites among paralogous genes of human tyrosine phosphatase family, DNA mismatch repair family, and zinc finger family, respectively. All miRNA binding sites are located within CDSs of studied mRNAs. Nucleotide sequences of hsa-miR-1279 binding sites with mRNAs of human PTPN12, MSH6, and ZEB1 genes encode TKEQYE, EGSSDE, and GEKPYE oligopeptides, respectively. The conservation of miRNA binding sites encoding oligopeptides has been revealed. MRNAs of many paralogs of zinc finger gene family have from 1 to 12 binding sites coding the same GEKPYE hexapeptide. MRNAs of PTPN12, MSH6, and ZEB1 orthologous genes from different animal species have binding sites for hsa-miR-1279 which consist of homologous oligonucleotides encoding similar human oligopeptides TKEQYE, EGSSDE, and GEKPYE. MiR-548j, miR-548m, and miR-548d-5p have homologous binding sites in the mRNA of PTPN12 orthologous genes which encode PRTRSC, TEATDI, and STASAT oligopeptides, respectively. All regions of miRNA are important for binding with the mRNA. Anatoliy T. Ivashchenko, Assel S. Issabekova, and Olga A. Berillo Copyright © 2013 Anatoliy T. Ivashchenko et al. All rights reserved. miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes Thu, 11 Jul 2013 13:56:09 +0000 http://www.hindawi.com/journals/bmri/2013/307145/ We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family. Assyl Bari, Saltanat Orazova, and Anatoliy Ivashchenko Copyright © 2013 Assyl Bari et al. All rights reserved. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization Tue, 09 Jul 2013 11:26:40 +0000 http://www.hindawi.com/journals/bmri/2013/465213/ Virulence is the primary factor used for selection of entomopathogenic fungi (EPF) for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates. Saliou Niassy, Sevgan Subramanian, Sunday Ekesi, Joel L. Bargul, Jandouwe Villinger, and Nguya K. Maniania Copyright © 2013 Saliou Niassy et al. All rights reserved. Erratum to “DNA, RNA, and Protein Extraction: The Past and the Present” Wed, 26 Jun 2013 13:50:28 +0000 http://www.hindawi.com/journals/bmri/2013/628968/ Siun Chee Tan and Beow Chin Yiap Copyright © 2013 Siun Chee Tan and Beow Chin Yiap. All rights reserved. Molecular Functions of Thyroid Hormones and Their Clinical Significance in Liver-Related Diseases Wed, 26 Jun 2013 13:35:35 +0000 http://www.hindawi.com/journals/bmri/2013/601361/ Thyroid hormones (THs) are potent mediators of several physiological processes, including embryonic development, cellular differentiation, metabolism, and cell growth. Triiodothyronine (T3) is the most biologically active TH form. Thyroid hormone receptors (TRs) belong to the nuclear receptor superfamily and mediate the biological functions of T3 via transcriptional regulation. TRs generally form heterodimers with the retinoid X receptor (RXR) and regulate target genes upon T3 stimulation. Research over the past few decades has revealed that disruption of cellular TH signaling triggers chronic liver diseases, including alcoholic or nonalcoholic fatty liver disease and hepatocellular carcinoma (HCC). Animal model experiments and epidemiologic studies to date imply close associations between high TH levels and prevention of liver disease. Moreover, several investigations spanning four decades have reported the therapeutic potential of T3 analogs in lowering lipids, preventing chronic liver disease, and as anticancer agents. Thus, elucidating downstream genes/signaling pathways and molecular mechanisms of TH actions is critical for the treatment of significant public health issues. Here, we have reviewed recent studies focusing on the roles of THs and TRs in several disorders, in particular, liver diseases. We also discuss the potential therapeutic applications of THs and underlying molecular mechanisms. Hsiang Cheng Chi, Cheng-Yi Chen, Ming-Ming Tsai, Chung-Ying Tsai, and Kwang-Huei Lin Copyright © 2013 Hsiang Cheng Chi et al. All rights reserved. Molecular Fingerprints to Identify Candida Species Mon, 17 Jun 2013 18:48:38 +0000 http://www.hindawi.com/journals/bmri/2013/923742/ A wide range of molecular techniques have been developed for genotyping Candida species. Among them, multilocus sequence typing (MLST) and microsatellite length polymorphisms (MLP) analysis have recently emerged. MLST relies on DNA sequences of internal regions of various independent housekeeping genes, while MLP identifies microsatellite instability. Both methods generate unambiguous and highly reproducible data. Here, we review the results achieved by using these two techniques and also provide a brief overview of a new method based on high-resolution DNA melting (HRM). This method identifies sequence differences by subtle deviations in sample melting profiles in the presence of saturating fluorescent DNA binding dyes. Claudia Spampinato and Darío Leonardi Copyright © 2013 Claudia Spampinato and Darío Leonardi. All rights reserved. Origin and Status of Homologous Proteins of Biomineralization (Biosilicification) in the Taxonomy of Phylogenetic Domains Thu, 13 Jun 2013 15:39:57 +0000 http://www.hindawi.com/journals/bmri/2013/397278/ The taxonomic affiliation (in the systematisation of viruses, and biological domains) of known peptides and proteins of biomineralization (silicateins, silaffins, silacidins and silicase) and their primary structure homologues were analyzed (methods in silico; using Uniprot database). The total number of known peptides and proteins of biosilicification was counted. The data of the quantitative distribution of the detected homologues found in nature are presented. The similarity of the primary structures of silaffins, silacidins, silicateins, silicase, and their homologues was 21–94%, 45–98%, 39–50%, and 28–40%, respectively. These homologues are found in many organisms, from the Protista to the higher plants and animals, including humans, as well as in bacteria and extracellular agents, and they perform a variety of biological functions, such as biologically controlled mineralisation. The provisional classification of these biomineralization proteins is presented. The interrelation of the origin of the first organic polymers and biomineralization is discussed. Igor E. Pamirsky and Kirill S. Golokhvast Copyright © 2013 Igor E. Pamirsky and Kirill S. Golokhvast. All rights reserved. Comparison between the Repression Potency of siRNA Targeting the Coding Region and the 3′-Untranslated Region of mRNA Wed, 12 Jun 2013 09:49:15 +0000 http://www.hindawi.com/journals/bmri/2013/637850/ Small interfering RNAs (siRNAs) are applied for post-transcriptional gene silencing by binding target mRNA. A target coding region is usually chosen, although the -untranslated region (-UTR) can also be a target. This study elucidates whether the coding region or -UTR elicits higher repression. pFLuc and pRLuc are two reporter plasmids. A segment of FLuc gene was PCR-amplified and inserted behind the stop codon of the RLuc gene of the pRLuc. Similarly, a segment of RLuc gene was inserted behind the stop codon of FLuc. Two siFLuc and two siRLuc were siRNAs designed to target the central portions of these segments. Therefore, the siRNA encountered the same targets and flanking sequences. Results showed that the two siFLuc elicited higher repression when the FLuc segment resided in the coding region. Conversely, the two siRLuc showed higher repression when the RLuc segment was in the -UTR. These results indicate that both the coding region and the -UTR can be more effective targets. The thermodynamic stability of the secondary structures was analyzed. The siRNA elicited higher repression in the coding region when the target configuration was stable, and needed to be solved by translation. A siRNA may otherwise favor the target at -UTR. Ching-Fang Lai, Chih-Ying Chen, and Lo-Chun Au Copyright © 2013 Ching-Fang Lai et al. All rights reserved. Stability and Accuracy Assessment of Identification of Traditional Chinese Materia Medica Using DNA Barcoding: A Case Study on Flos Lonicerae Japonicae Wed, 05 Jun 2013 15:23:26 +0000 http://www.hindawi.com/journals/bmri/2013/549037/ DNA barcoding is a novel molecular identification method that aids in identifying traditional Chinese materia medica using traditional identification techniques. However, further study is needed to assess the stability and accuracy of DNA barcoding. Flos Lonicerae Japonicae, a typical medicinal flower, is widely used in China, Korea, and other Southeast Asian countries. However, Flos Lonicerae Japonicae and its closely related species have been misused and traded at varying for a wide range of prices. Therefore, Flos Lonicerae Japonicae must be accurately identified. In this study, the ITS2 and psbA-trnH regions were amplified by polymerase chain reaction (PCR). Sequence assembly was performed using CodonCode Aligner V 3.5.4. The intra- versus inter-specific variations were assessed using six metrics and “barcoding gaps.” Species identification was conducted using BLAST1 and neighbor-joining (NJ) trees. Results reveal that ITS2 and psbA-trnH exhibited an average intraspecific divergence of 0.001 and 0, respectively, as well as an average inter-specific divergence of 0.0331 and 0.0161. The identification efficiency of ITS2 and psbA-trnH evaluated using BLAST1 was 100%. Flos Lonicerae Japonicae was formed into one clade through the NJ trees. Therefore, Flos Lonicerae Japonicae can be stably and accurately identified through the ITS2 and psbA-trnH regions, respectively. Dianyun Hou, Jingyuan Song, Linchun Shi, Xiaochong Ma, Tianyi Xin, Jianping Han, Wei Xiao, Zhiying Sun, Ruiyang Cheng, and Hui Yao Copyright © 2013 Dianyun Hou et al. All rights reserved. Molecular Identification and Ultrastructural and Phylogenetic Studies of Cyanobacteria from Association with the White Sea Hydroid Dynamena pumila (L., 1758) Wed, 22 May 2013 14:55:38 +0000 http://www.hindawi.com/journals/bmri/2013/760681/ Three new cyanobacterial strains, that have been previously purified from the hydroid Dynamena pumila (L., 1758), isolated from the White Sea, were studied using scanning and transmission electron microscopy methods and were characterized by using almost complete sequence of the 16S rRNA gene, internal transcribed spacer 16S-23S rRNA, and part of the gene for 23S rRNA. The full nucleotide sequences of the rRNA gene clusters were deposited to GenBank (HM064496.1, GU265558.1, JQ259187.1). Comparison of rRNA gene cluster sequences of Synechococcus cyanobacterium 1Dp66E-1, Oscillatoriales cyanobacterium 2Dp86E, and Nostoc sp. 10Dp66E with all sequences present at the GenBank shows that these cyanobacterial strains do not have 100% identity with any organisms investigated previously. Furthermore, for the first time heterotrophic bacterium, associated with Nostoc sp. 10Dp66E, was identified as a member of the new phylum Gemmatimonadetes, genus of Gemmatimonas (GenBank accession number is JX437625.1). Phylogenetic analysis showed that cyanobacterium Synechococcus sp. 1Dp66E-1 forms the unique branch and belongs to a cluster of Synechococcus, including freshwater and sea strains. Oscillatoriales cyanobacterium 2Dp86E belongs to a cluster of Leptolyngbya strains. Isolate Nostoc sp. 10Dp66E forms unique branch and belongs to a cluster of the genus Nostoc, with the closest relative of Nostoc commune isolates. O. A. Koksharova, T. R. Kravzova, I. V. Lazebnaya, O. A. Gorelova, O. I. Baulina, O. E. Lazebny, T. A. Fedorenko, and E. S. Lobakova Copyright © 2013 O. A. Koksharova et al. All rights reserved. Analytical Methodologies for the Determination of Endocrine Disrupting Compounds in Biological and Environmental Samples Wed, 08 May 2013 16:40:27 +0000 http://www.hindawi.com/journals/bmri/2013/674838/ Endocrine-disruptor compounds (EDCs) can mimic natural hormones and produce adverse effects in the endocrine functions by interacting with estrogen receptors. EDCs include both natural and synthetic chemicals, such as hormones, personal care products, surfactants, and flame retardants, among others. EDCs are characterised by their ubiquitous presence at trace-level concentrations and their wide diversity. Since the discovery of the adverse effects of these pollutants on wildlife and human health, analytical methods have been developed for their qualitative and quantitative determination. In particular, mass-based analytical methods show excellent sensitivity and precision for their quantification. This paper reviews recently published analytical methodologies for the sample preparation and for the determination of these compounds in different environmental and biological matrices by liquid chromatography coupled with mass spectrometry. The various sample preparation techniques are compared and discussed. In addition, recent developments and advances in this field are presented. Zoraida Sosa-Ferrera, Cristina Mahugo-Santana, and José Juan Santana-Rodríguez Copyright © 2013 Zoraida Sosa-Ferrera et al. All rights reserved. Construction and Preliminary Characterization Analysis of Wuzhishan Miniature Pig Bacterial Artificial Chromosome Library with Approximately 8-Fold Genome Equivalent Coverage Thu, 18 Apr 2013 13:49:49 +0000 http://www.hindawi.com/journals/bmri/2013/587493/ Bacterial artificial chromosome (BAC) libraries have been invaluable tools for the genome-wide genetic dissection of complex organisms. Here, we report the construction and characterization of a high-redundancy BAC library from a very valuable pig breed in China, Wuzhishan miniature pig (Sus scrofa), using its blood cells and fibroblasts, respectively. The library contains approximately 153,600 clones ordered in 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 152.3 kb, representing approximately 7.68 genome equivalents of the porcine haploid genome and a 99.93% statistical probability of obtaining at least one clone containing a unique DNA sequence in the library. 19 pairs of microsatellite marker primers covering porcine chromosomes were used for screening the BAC library, which showed that each of these markers was positive in the library; the positive clone number was 2 to 9, and the average number was 7.89, which was consistent with 7.68-fold coverage of the porcine genome. And there were no significant differences of genomic BAC library from blood cells and fibroblast cells. Therefore, we identified 19 microsatellite markers that could potentially be used as genetic markers. As a result, this BAC library will serve as a valuable resource for gene identification, physical mapping, and comparative genomics and large-scale genome sequencing in the porcine. Changqing Liu, Yuo Guo, Taofeng Lu, Hongmei Wu, Risu Na, Xiangchen Li, Weijun Guan, and Yuehui Ma Copyright © 2013 Changqing Liu et al. All rights reserved. Development of an Ammonium Sulfate DNA Extraction Method for Obtaining Amplifiable DNA in a Small Number of Cells and Its Application to Clinical Specimens Wed, 17 Apr 2013 08:40:33 +0000 http://www.hindawi.com/journals/bmri/2013/546727/ DNA extraction from microdissected cells has become essential for handling clinical specimens with advances in molecular pathology. Conventional methods have limitations for extracting amplifiable DNA from specimens containing a small number of cells. We developed an ammonium sulfate DNA extraction method (A) and compared it with two other methods (B and C). DNA quality and quantity, β-globin amplification, and detectability of two cancer associated gene mutations were evaluated. Method A showed the best DNA yield, particularly when the cell number was very low. Amplification of the β-globin gene using DNA from the SNU 790 cell line and papillary thyroid carcinoma (PTC) cells extracted with Method A demonstrated the strongest band. BRAFV600E mutation analysis using ethanol-fixed PTC cells from a patient demonstrated both a “T” peak increase and an adjacent “A” peak decrease when 25 and 50 cells were extracted, whereas mutant peaks were too low to be analyzed using the other two methods. EGFR mutation analysis using formalin-fixed paraffin-embedded lung cancer tissues demonstrated a mutant peak with Method A, whereas the mutant peak was undetectable with Methods B or C. Method A yielded the best DNA quantity and quality with outstanding efficiency, particularly when paucicellular specimens were used. Seo Young Oh, Wook Youn Kim, Tae Sook Hwang, Hye Seung Han, So Dug Lim, and Wan Seop Kim Copyright © 2013 Seo Young Oh et al. All rights reserved. Molecular Techniques for Dicistrovirus Detection without RNA Extraction or Purification Thu, 04 Apr 2013 16:21:53 +0000 http://www.hindawi.com/journals/bmri/2013/218593/ Dicistroviridae is a new family of small, nonenveloped, and +ssRNA viruses pathogenic to both beneficial arthropods and insect pests as well. Triatoma virus (TrV), a dicistrovirus, is a pathogen of Triatoma infestans (Hemiptera: Reduviidae), one of the main vectors of Chagas disease. In this work, we report a single-step method to identify TrV, a dicistrovirus, isolated from fecal samples of triatomines. The identification method proved to be quite sensitive, even without the extraction and purification of RNA virus. Jailson F. B. Querido, Jon Agirre, Gerardo A. Marti, Diego M. A. Guérin, and Marcelo Sousa Silva Copyright © 2013 Jailson F. B. Querido et al. All rights reserved. Titanium Surface Coating with a Laminin-Derived Functional Peptide Promotes Bone Cell Adhesion Mon, 25 Mar 2013 12:41:55 +0000 http://www.hindawi.com/journals/bmri/2013/638348/ Laminin-derived peptide coatings can enhance epithelial cell adhesion to implants, and the positive effect of these peptides on bone cell adhesion has been anticipated. The purpose of this study was to evaluate the improvement in bone cell attachment to and activity on titanium (Ti) scaffolds coated with a laminin-derived functional peptide, Ln2-P3 (the DLTIDDSYWYRI motif). Four Ti disc surfaces were prepared, and a human osteosarcoma (HOS) cell attachment test was performed to select two candidate surfaces for peptide coating. These two candidates were then coated with Ln2-P3 peptide, a scrambled peptide, or left uncoated to measure cell attachment to each surface, following which one surface was chosen to assess alkaline phosphatase (ALP) activity and osteogenic marker gene expression with quantitative real-time PCR. On the commercially pure Ti surface, the Ln2-P3 coating significantly increased cellular ALP activity and the expression levels of ALP and bone sialoprotein mRNA as compared with the scrambled peptide-coated and uncoated surfaces. In conclusion, although further in vivo studies are needed, the findings of this in vitro study indicate that the Ln2-P3-coated implant surface promotes bone cell adhesion, which has clinical implications for reducing the overall treatment time of dental implant therapy. Seung-Ki Min, Hyun Ki Kang, Da Hyun Jang, Sung Youn Jung, O. Bok Kim, Byung-Moo Min, and In-Sung Yeo Copyright © 2013 Seung-Ki Min et al. All rights reserved. Adhesion, Growth, and Maturation of Vascular Smooth Muscle Cells on Low-Density Polyethylene Grafted with Bioactive Substances Sun, 24 Mar 2013 10:28:40 +0000 http://www.hindawi.com/journals/bmri/2013/371430/ The attractiveness of synthetic polymers for cell colonization can be affected by physical, chemical, and biological modification of the polymer surface. In this study, low-density polyethylene (LDPE) was treated by an Ar+ plasma discharge and then grafted with biologically active substances, namely, glycine (Gly), polyethylene glycol (PEG), bovine serum albumin (BSA), colloidal carbon particles (C), or BSA+C. All modifications increased the oxygen content, the wettability, and the surface free energy of the materials compared to the pristine LDPE, but these changes were most pronounced in LDPE with Gly or PEG, where all the three values were higher than in the only plasma-treated samples. When seeded with vascular smooth muscle cells (VSMCs), the Gly- or PEG-grafted samples increased mainly the spreading and concentration of focal adhesion proteins talin and vinculin in these cells. LDPE grafted with BSA or BSA+C showed a similar oxygen content and similar wettability, as the samples only treated with plasma, but the nano- and submicron-scale irregularities on their surface were more pronounced and of a different shape. These samples promoted predominantly the growth, the formation of a confluent layer, and phenotypic maturation of VSMC, demonstrated by higher concentrations of contractile proteins alpha-actin and SM1 and SM2 myosins. Thus, the behavior of VSMC on LDPE can be regulated by the type of bioactive substances that are grafted. Martin Parizek, Nikola Slepickova Kasalkova, Lucie Bacakova, Zdenek Svindrych, Petr Slepicka, Marketa Bacakova, Vera Lisa, and Vaclav Svorcik Copyright © 2013 Martin Parizek et al. All rights reserved. Antitumoral Potential of Tunisian Snake Venoms Secreted Phospholipases A2 Thu, 31 Jan 2013 13:46:41 +0000 http://www.hindawi.com/journals/bmri/2013/391389/ Phospholipases type A2 (PLA2s) are the most abundant proteins found in Viperidae snake venom. They are quite fascinating from both a biological and structural point of view. Despite similarity in their structures and common catalytic properties, they exhibit a wide spectrum of pharmacological activities. Besides being hydrolases, secreted phospholipases A2 (sPLA2) are an important group of toxins, whose action at the molecular level is still a matter of debate. These proteins can display toxic effects by different mechanisms. In addition to neurotoxicity, myotoxicity, hemolytic activity, antibacterial, anticoagulant, and antiplatelet effects, some venom PLA2s show antitumor and antiangiogenic activities by mechanisms independent of their enzymatic activity. This paper aims to discuss original finding against anti-tumor and anti-angiogenic activities of sPLA2 isolated from Tunisian vipers: Cerastes cerastes and Macrovipera lebetina, representing new tools to target specific integrins, mainly, and integrins. Raoudha Zouari-Kessentini, Najet Srairi-Abid, Amine Bazaa, Mohamed El Ayeb, Jose Luis, and Naziha Marrakchi Copyright © 2013 Raoudha Zouari-Kessentini et al. All rights reserved. Understanding the Molecular Mechanism and Structure-Function Relationship of the Toxicity of PLA2 and K49 Homologs in Snake Venom Thu, 31 Jan 2013 13:38:23 +0000 http://www.hindawi.com/journals/bmri/2013/243047/ Luis Alberto Ponce-Soto, Laura Leiva, and Elen Cristina Teizem Landucci Copyright © 2013 Luis Alberto Ponce-Soto et al. All rights reserved. Unmasking Snake Venom of Bothrops leucurus: Purification and Pharmacological and Structural Characterization of New PL Bleu TX-III Wed, 09 Jan 2013 10:46:52 +0000 http://www.hindawi.com/journals/bmri/2013/941467/ Bleu TX-III was isolated from Bothrops leucurus snake venom on one-step analytical chromatography reverse phase HPLC, was homogeneous on SDS-PAGE, and was confirmed by Q-Tof Ultima API ESI/MS (TOF MS mode) mass spectrometry in 14243.8 Da. Multiple alignments of Bleu TX-III show high degree of homology with basic PLA2 myotoxins from other Bothrops venoms. Our studies on local and systemic myotoxicity “in vivo” reveal that Bleu TX-III is myotoxin with local but not systemic action due to the decrease in the plasmatic CK levels when Bleu TX-III is administrated by intravenous route in mice (dose 1 and 5 μg). And at a dose of 20 μg myotoxin behaves like a local and systemic action. Bleu TX-III induced moderate marked paw edema, evidencing the local increase in vascular permeability. The inflammatory events induced in the mice (I.M.) were investigated. The increase in the levels of IL-1, IL-6, and TNF-α was observed in the plasma. It is concluded that Bleu TX-III induces inflammatory events in this model. The enzymatic phospholipid hydrolysis may be relevant to these phenomena. Bothrops leucurus venom is still not extensively explored, and the knowledge of its toxins separately through the study of structure/function will contribute for a better understanding of its action mechanism. Fábio André Marangoni, Luis Alberto Ponce-Soto, Sergio Marangoni, and Elen Cristina Teizem Landucci Copyright © 2013 Fábio André Marangoni et al. All rights reserved. Molecular Cloning, Expression, Purification, and Functional Characterization of Dammarenediol Synthase from Panax ginseng Sun, 30 Dec 2012 16:46:02 +0000 http://www.hindawi.com/journals/bmri/2013/285740/ The objective of this study is to clone and charecterize the expression of dammarenediol synthase gene and then to determine the relationship between the expression of dammarenediol synthase gene that is involved in the ginsenoside biosynthetic pathway and the ginsenoside content. A cDNA phage library was constructed from a five-year-old ginseng root. The cDNA library was screened for the dammarenediol synthase gene by using its specific primers. It was further cloned and expressed in pET-30a vector. The recombinant plasmid pET-30a-DS was expressed in Rosetta E. coli. The recombinant DS protein was purified by affinity chromatography. The production of dammarenediol was detected by liquid chromatography-mass spectrometry (LC-MS). Results showed that dammarenediol synthase gene was cloned from the cDNA library and was expressed in Rosetta E. coli and the SDS-PAGE analysis showed the presence of purified DS protein. LS-MS showed the activity of DS protein, as the protein content increases the dammarenediol increases. Our results indicate that the recombinant dammarenediol synthase protein could increase the production of dammarenediol and the expression of DS played a vital role in the biosynthesis of ginsenosides in P. ginseng. Wei Hu, Ning Liu, Yuhua Tian, and Lianxue Zhang Copyright © 2013 Wei Hu et al. All rights reserved. Biochemical Characterization and Pharmacological Properties of New Basic PLA2 BrTX-I Isolated from Bothrops roedingeri (Roedinger's Lancehead) Mertens, 1942, Snake Venom Sun, 30 Dec 2012 08:57:44 +0000 http://www.hindawi.com/journals/bmri/2013/591470/ BrTX-I, a PLA2, was purified from Bothrops roedingeri venom after only one chromatographic step using reverse-phase HPLC on μ-Bondapak C-18 column. A molecular mass of 14358.69 Da was determined by MALDI-TOF mass spectrometry. Amino acid analysis showed a high content of hydrophobic and basic amino acids as well as 14 half-cysteine residues. The total amino acid sequence was obtained using SwissProt database and showed high amino acid sequence identity with other PLA2 from snake venom. The amino acid composition showed that BrTX-I has a high content of Lys, Tyr, Gly, Pro, and 14 half-Cys residues, typical of a basic PLA2. BrTX-I presented PLA2 activity and showed a minimum sigmoidal behavior, reaching its maximal activity at pH 8.0, 35–45°C, and required Ca2+. In vitro, the whole venom and BrTX-I caused a neuromuscular blockade in biventer cervicis preparations in a similar way to other Bothrops species. BrTX-I induced myonecrosis and oedema-forming activity analyzed through injection of the purified BrTX-I in mice. Since BrTX-I exerts a strong proinflammatory effect, the enzymatic phospholipid hydrolysis might be relevant for these phenomena; incrementing levels of IL-1, IL-6, and TNFα were observed at 15 min, 30 min, one, two, and six hours postinjection, respectively. Mauricio Aurelio Gomes Heleno, Paulo Aparecido Baldasso, Luis Alberto Ponce-Soto, and Sérgio Marangoni Copyright © 2013 Mauricio Aurelio Gomes Heleno et al. All rights reserved. Biochemical, Pharmacological, and Structural Characterization of New Basic Bbil-TX from Bothriopsis bilineata Snake Venom Sun, 30 Dec 2012 07:41:48 +0000 http://www.hindawi.com/journals/bmri/2013/612649/ Bbil-TX, a PLA2, was purified from Bothriopsis bilineata snake venom after only one chromatographic step using RP-HPLC on μ-Bondapak C-18 column. A molecular mass of 14243.8 Da was confirmed by Q-Tof Ultima API ESI/MS (TOF MS mode) mass spectrometry. The partial protein sequence obtained was then submitted to BLASTp, with the search restricted to PLA2 from snakes and shows high identity values when compared to other PLA2s. PLA2 activity was presented in the presence of a synthetic substrate and showed a minimum sigmoidal behavior, reaching its maximal activity at pH 8.0 and 25–37∘C. Maximum PLA2 activity required Ca2+ and in the presence of Cd2+, Zn2+, Mn2+, and Mg2+ it was reduced in the presence or absence of Ca2+. Crotapotin from Crotalus durissus cascavella rattlesnake venom and antihemorrhagic factor DA2-II from Didelphis albiventris opossum sera under optimal conditions significantly inhibit the enzymatic activity. Bbil-TX induces myonecrosis in mice. The fraction does not show a significant cytotoxic activity in myotubes and myoblasts (C2C12). The inflammatory events induced in the serum of mice by Bbil-TX isolated from Bothriopsis bilineata snake venom were investigated. An increase in vascular permeability and in the levels of TNF-a, IL-6, and IL-1 was was induced. Since Bbil-TX exerts a stronger proinflammatory effect, the phospholipid hydrolysis may be relevant for these phenomena. Victor Corasolla Carregari, Rafael Stuani Floriano, Lea Rodrigues-Simioni, Flavia V. Winck, Paulo Aparecido Baldasso, Luis Alberto Ponce-Soto, and Sergio Marangoni Copyright © 2013 Victor Corasolla Carregari et al. All rights reserved. Synergistic Effects of Secretory Phospholipase A2 from the Venom of Agkistrodon piscivorus piscivorus with Cancer Chemotherapeutic Agents Thu, 27 Dec 2012 08:21:24 +0000 http://www.hindawi.com/journals/bmri/2013/565287/ Healthy cells typically resist hydrolysis catalyzed by snake venom secretory phospholipase A2. However, during various forms of programmed cell death, they become vulnerable to attack by the enzyme. This observation raises the question of whether the specificity of the enzyme for dying cells could be used as a strategy to eliminate tumor cells that have been intoxicated but not directly killed by chemotherapeutic agents. This idea was tested with S49 lymphoma cells and a broad range of antineoplastic drugs: methotrexate, daunorubicin, actinomycin D, and paclitaxel. In each case, a substantial population of treated cells was still alive yet vulnerable to attack by the enzyme. Induction of cell death by these agents also perturbed the biophysical properties of the membrane as detected by merocyanine 540 and trimethylammonium-diphenylhexatriene. These results suggest that exposure of lymphoma cells to these drugs universally causes changes to the cell membrane that render it susceptible to enzymatic attack. The data also argue that the snake venom enzyme is not only capable of clearing cell corpses but can aid in the demise of tumor cells that have initiated but not yet completed the death process. Jennifer Nelson, Kristen Barlow, D. Olin Beck, Amanda Berbert, Nathan Eshenroder, Lyndee Francom, Mark Pruitt, Kina Thompson, Kyle Thompson, Brian Thurber, Celestine H.-Y. Yeung, Allan M. Judd, and John D. Bell Copyright © 2013 Jennifer Nelson et al. All rights reserved. Biochemical Characterization, Action on Macrophages, and Superoxide Anion Production of Four Basic Phospholipases A2 from Panamanian Bothrops asper Snake Venom Mon, 24 Dec 2012 07:50:21 +0000 http://www.hindawi.com/journals/bmri/2013/789689/ Bothrops asper (Squamata: Viperidae) is the most important venomous snake in Central America, being responsible for the majority of snakebite accidents. Four basic PLA2s (pMTX-I to -IV) were purified from crude venom by a single-step chromatography using a CM-Sepharose ion-exchange column (1.5 × 15 cm). Analysis of the N-terminal sequence demonstrated that pMTX-I and III belong to the catalytically active Asp49 phospholipase A2 subclass, whereas pMTX-II and IV belong to the enzymatically inactive Lys49 PLA2s-like subclass. The PLA2s isolated from Panama Bothrops asper venom (pMTX-I, II, III, and IV) are able to induce myotoxic activity, inflammatory reaction mainly leukocyte migration to the muscle, and induce J774A.1 macrophages activation to start phagocytic activity and superoxide production. Aristides Quintero Rueda, Isela González Rodríguez, Eliane C. Arantes, Sulamita S. Setúbal, Leonardo de A. Calderon, Juliana P. Zuliani, Rodrigo G. Stábeli, and Andreimar M. Soares Copyright © 2013 Aristides Quintero Rueda et al. All rights reserved. A Lys49 Phospholipase , Isolated from Bothrops asper Snake Venom, Induces Lipid Droplet Formation in Macrophages Which Depends on Distinct Signaling Pathways and the C-Terminal Region Mon, 24 Dec 2012 07:36:13 +0000 http://www.hindawi.com/journals/bmri/2013/807982/ MT-II, a Lys49PLA2 homologue devoid of catalytic activity from B. asper venom, stimulates inflammatory events in macrophages. We investigated the ability of MT-II to induce formation of lipid droplets (LDs), key elements of inflammatory responses, in isolated macrophages and participation of protein kinases and intracellular PLA2s in this effect. Influence of MT-II on PLIN2 recruitment and expression was assessed, and the effects of some synthetic peptides on LD formation were further evaluated. At noncytotoxic concentrations, MT-II directly activated macrophages to form LDs. This effect was reproduced by a synthetic peptide corresponding to the C-terminal sequence 115–129 of MT-II, evidencing the critical role of C-terminus for MT-II-induced effect. Moreover, MT-II induced expression and recruitment of PLIN2. Pharmacological interventions with specific inhibitors showed that PKC, PI3K, ERK1/2, and iPLA2, but not or cPLA2, signaling pathways are involved in LD formation induced by MT-II. This sPLA2 homologue also induced synthesis of PGE2 that colocalized to LDs. In conclusion, MT-II is able to induce formation of LDs committed to PGE2 formation in a process dependent on C-terminal loop engagement and regulated by distinct protein kinases and iPLA2. LDs may constitute an important inflammatory mechanism triggered by MT-II in macrophages. Karina Cristina Giannotti, Elbio Leiguez, Vanessa Moreira, Neide Galvão Nascimento, Bruno Lomonte, José Maria Gutiérrez, Robson Lopes de Melo, and Catarina Teixeira Copyright © 2013 Karina Cristina Giannotti et al. All rights reserved. Induction of Mast-Cell Accumulation by Promutoxin, an Arg-49 Phospholipase Thu, 20 Dec 2012 16:26:34 +0000 http://www.hindawi.com/journals/bmri/2013/206061/ Local inflammation is a prominent characteristic of snakebite wound, and snake-venom phospholipase A2s (PLA2s) are some of the main component that contribute to accumulation of inflammatory cells. However, the action of an R49 PLA2s, promutoxin from Protobothrops mucrosquamatus venom, on mast-cell accumulation has not been previously examined. Using a mouse peritoneal model, we found that promutoxin can induce approximately-6-fold increase in mast-cell accumulation, and the response lasts at least for 16 h. The promutoxin-induced mast cell accumulation was inhibited by cyproheptadine, terfenadine, and Ginkgolide B, indicating that histamine and platelet-activating factor (PAF) is likely to contribute to the mast-cells accumulation. Preinjection of antibodies against adhesion molecules ICAM-1, CD18, CD11a, and L-selectin showed that ICAM-1, and CD18, CD11a are key adhesion molecules of promutoxin-induced mast-cell accumulation. In conclusion, promutoxin can induce accumulation of mast cells, which may contribute to snake-venom wound. Ji-Fu Wei, Xiao-Long Wei, Ya-Zhen Mo, Haiwei Yang, and Shaoheng He Copyright © 2013 Ji-Fu Wei et al. All rights reserved. A Versatile Star PEG Grafting Method for the Generation of Nonfouling and Nonthrombogenic Surfaces Thu, 20 Dec 2012 08:09:04 +0000 http://www.hindawi.com/journals/bmri/2013/962376/ Polyethylene glycol (PEG) grafting has a great potential to create nonfouling and nonthrombogenic surfaces, but present techniques lack versatility and stability. The present work aimed to develop a versatile PEG grafting method applicable to most biomaterial surfaces, by taking advantage of novel primary amine-rich plasma-polymerized coatings. Star-shaped PEG covalent binding was studied using static contact angle, X-ray photoelectron spectroscopy (XPS), and quartz crystal microbalance with dissipation monitoring (QCM-D). Fluorescence and QCM-D both confirmed strong reduction of protein adsorption when compared to plasma-polymerized coatings and pristine poly(ethyleneterephthalate) (PET). Moreover, almost no platelet adhesion was observed after 15 min perfusion in whole blood. Altogether, our results suggest that primary amine-rich plasma-polymerized coatings offer a promising stable and versatile method for PEG grafting in order to create nonfouling and nonthrombogenic surfaces and micropatterns. Pradeep Kumar Thalla, Angel Contreras-García, Hicham Fadlallah, Jérémie Barrette, Gregory De Crescenzo, Yahye Merhi, and Sophie Lerouge Copyright © 2013 Pradeep Kumar Thalla et al. All rights reserved. Chemical Modifications of PhTX-I Myotoxin from Porthidium hyoprora Snake Venom: Effects on Structural, Enzymatic, and Pharmacological Properties Wed, 19 Dec 2012 15:33:40 +0000 http://www.hindawi.com/journals/bmri/2013/103494/ We recently described the isolation of a basic PLA2 (PhTX-I) from Porthidium hyoprora snake venom. This toxin exhibits high catalytic activity, induces in vivo myotoxicity, moderates footpad edema, and causes in vitro neuromuscular blockade. Here, we describe the chemical modifications of specific amino acid residues (His, Tyr, Lys, and Trp), performed in PhTX-I, to study their effects on the structural, enzymatic, and pharmacological properties of this myotoxin. After chemical treatment, a single His, 4 Tyr, 7 Lys, and one Trp residues were modified. The secondary structure of the protein remained unchanged as measured by circular dichroism; however other results indicated the critical role played by Lys and Tyr residues in myotoxic, neurotoxic activities and mainly in the cytotoxicity displayed by PhTX-I. His residue and therefore catalytic activity of PhTX-I are relevant for edematogenic, neurotoxic, and myotoxic effects, but not for its cytotoxic activity. This dissociation observed between enzymatic activity and some pharmacological effects suggests that other molecular regions distinct from the catalytic site may also play a role in the toxic activities exerted by this myotoxin. Our observations supported the hypothesis that both the catalytic sites as the hypothetical pharmacological sites are relevant to the pharmacological profile of PhTX-I. Salomón Huancahuire-Vega, Daniel H. A. Corrêa, Luciana M. Hollanda, Marcelo Lancellotti, Carlos H. I. Ramos, Luis Alberto Ponce-Soto, and Sergio Marangoni Copyright © 2013 Salomón Huancahuire-Vega et al. All rights reserved. A MicroRNA Component of the Neoplastic Microenvironment: Microregulators with Far-Reaching Impact Tue, 04 Dec 2012 16:33:51 +0000 http://www.hindawi.com/journals/bmri/2013/762183/ The interplay between tumor cells and their microenvironment plays a pivotal role in tumor development and progression. Although a growing body of evidence has established the importance of the tumor microenvironment, an understanding of the crosstalk between its components and cancer cells remains elusive. The pathways triggered by microenvironmental factors could modulate cancer-related gene transcription, also affecting small noncoding RNAs, microRNAs, which have emerged as key posttranscriptional regulators of gene expression, directly involved in human cancers. Although microRNAs regulate most biological mechanisms, their role in the tumor microenvironment has only recently become the focus of intense research. In this paper, we focus on the intertwined connection between the tumor microenvironment and aberrant expression of microRNAs involved in carcinogenesis. We also discuss the emerging roles of microRNAs in the tumor microenvironment as it relates to cancer progression. We conclude that microRNAs are critical for our understanding of the development of cancer, and that targeting microRNA signaling pathways in the microenvironment as well as in tumor cells opens new therapeutic avenues to the global control of cancer. Xiaolei Li, Zhiqiang Wu, Xiaobing Fu, and Weidong Han Copyright © 2013 Xiaolei Li et al. All rights reserved. Increased Expression of microRNA-17 Predicts Poor Prognosis in Human Glioma Mon, 19 Nov 2012 17:12:32 +0000 http://www.hindawi.com/journals/bmri/2012/970761/ Aim. To investigate the clinical significance of microRNA-17 (miR-17) expression in human gliomas. Methods. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to characterize the expression patterns of miR-17 in 108 glioma and 20 normal brain tissues. The associations of miR-17 expression with clinicopathological factors and prognosis of glioma patients were also statistically analyzed. Results. Compared with normal brain tissues, miR-17 expression was significantly higher in glioma tissues (). In addition, the increased expression of miR-17 in glioma was significantly associated with advanced pathological grade () and low Karnofsky performance score (KPS, ). Moreover, Kaplan-Meier survival and Cox regression analyses showed that miR-17 overexpression () and advanced pathological grade () were independent factors predicting poor prognosis for gliomas. Furthermore, subgroup analyses showed that miR-17 expression was significantly associated with poor overall survival in glioma patients with high pathological grades (for grade III~IV: ). Conclusions. Our data offer the convinced evidence that the increased expression of miR-17 may have potential value for predicting poor prognosis in glioma patients with high pathological grades, indicating that miR-17 may contribute to glioma progression and be a candidate therapeutic target for this disease. Shengkui Lu, Shuai Wang, Shaomei Geng, Shucheng Ma, Zhaohui Liang, and Baohua Jiao Copyright © 2012 Shengkui Lu et al. All rights reserved. Progesterone Downregulates Oestrogen-Induced Expression of CFTR and SLC26A6 Proteins and mRNA in Rats’ Uteri Sun, 11 Nov 2012 08:39:11 +0000 http://www.hindawi.com/journals/bmri/2012/596084/ Under progesterone (P) dominance, fluid loss assists uterine closure which is associated with pH reduction. We hypothesize that P inhibits uterine fluid secretion and transport. Aim. to investigate the expression of Cystic Fibrosis Transmembrane Regulator (CFTR) and Cl−/ exchanger (SLC26A6) under P effect. Method. Uteri from ovariectomized steroid replaced and intact rats at different stages of oestrous cycle were analyzed for changes in protein and mRNA expressions. Results. P inhibits CFTR and SLC26A6 proteins and mRNA expression while oestrogen (E) causes vice versa. E treatment followed by P causes a reduction in these transporters’ mRNA and protein. Similar changes occur throughout the oestrous cycle; that is, CFTR mRNA expression was high at proestrus while SLC26A6 mRNA and protein expressions were increased at proestrus and estrus. At diestrus, however, the expression of these transporters’ protein and mRNA was reduced. Conclusion. Inhibition of CFTR and SLC26A6 expressions may explain the reduced fluid volume and pH under P-mediated effect. K. Gholami, S. Muniandy, and N. Salleh Copyright © 2012 K. Gholami et al. All rights reserved. Molecular Mechanisms Involved in Inflammation and Insulin Resistance in Chronic Diseases and Possible Interventions Tue, 25 Sep 2012 17:48:44 +0000 http://www.hindawi.com/journals/bmri/2012/841983/ Renata Gorjão, Hilton Kenji Takahashi, Ji An Pan, and Sandro Massao Hirabara Copyright © 2012 Renata Gorjão et al. All rights reserved. Molecular Targets Related to Inflammation and Insulin Resistance and Potential Interventions Tue, 25 Sep 2012 11:07:04 +0000 http://www.hindawi.com/journals/bmri/2012/379024/ Inflammation and insulin resistance are common in several chronic diseases, such as obesity, type 2 diabetes mellitus, metabolic syndrome, cancer, and cardiovascular diseases. Various studies show a relationship between these two factors, although the mechanisms involved are not completely understood yet. Here, we discuss the molecular basis of insulin resistance and inflammation and the molecular aspects on inflammatory pathways interfering in insulin action. Moreover, we explore interventions based on molecular targets for preventing or treating correlated disorders, advances for a better characterization, and understanding of the mechanisms and mediators involved in the different inflammatory and insulin resistance conditions. Finally, we address biotechnological studies for the development of new potential therapies and interventions. Sandro M. Hirabara, Renata Gorjão, Marco A. Vinolo, Alice C. Rodrigues, Renato T. Nachbar, and Rui Curi Copyright © 2012 Sandro M. Hirabara et al. All rights reserved. The Immunologic Injury Composite with Balloon Injury Leads to Dyslipidemia: A Robust Rabbit Model of Human Atherosclerosis and Vulnerable Plaque Tue, 04 Sep 2012 08:30:12 +0000 http://www.hindawi.com/journals/bmri/2012/249129/ Atherosclerosis is a condition in which a lipid deposition, thrombus formation, immune cell infiltration, and a chronic inflammatory response, but its systemic study has been hampered by the lack of suitable animal models, especially in herbalism fields. We have tried to perform a perfect animal model that completely replicates the stages of human atherosclerosis. This is the first combined study about the immunologic injury and balloon injury based on the cholesterol diet. In this study, we developed a modified protocol of the white rabbit model that could represent a novel approach to studying human atherosclerosis and vulnerable plaque. Guangyin Zhang, Ming Li, Liangjun Li, Yingzhi Xu, Peng Li, Cui Yang, Yanan Zhou, and Junping Zhang Copyright © 2012 Guangyin Zhang et al. All rights reserved. Sunflower Oil Supplementation Has Proinflammatory Effects and Does Not Reverse Insulin Resistance in Obesity Induced by High-Fat Diet in C57BL/6 Mice Mon, 03 Sep 2012 13:24:32 +0000 http://www.hindawi.com/journals/bmri/2012/945131/ High consumption of polyunsaturated fatty acids, such as sunflower oil has been associated to beneficial effects in plasma lipid profile, but its role on inflammation and insulin resistance is not fully elucidated yet. We evaluated the effect of sunflower oil supplementation on inflammatory state and insulin resistance condition in HFD-induced obese mice. C57BL/6 male mice (8 weeks) were divided in four groups: (a) control diet (CD), (b) HFD, (c) CD supplemented with n-6 (CD + n-6), and (d) HFD supplemented with n-6 (HFD + n-6). CD + n-6 and HFD + n-6 were supplemented with sunflower oil by oral gavage at 2 g/Kg of body weight, three times per week. CD and HFD were supplemented with water instead at the same dose. HFD induced whole and muscle-specific insulin resistance associated with increased inflammatory markers in insulin-sensitive tissues and macrophage cells. Sunflower oil supplementation was not efficient in preventing or reducing these parameters. In addition, the supplementation increased pro-inflammatory cytokine production by macrophages and tissues. Lipid profile, on the other hand, was improved with the sunflower oil supplementation in animals fed HFD. In conclusion, sunflower oil supplementation improves lipid profile, but it does not prevent or attenuate insulin resistance and inflammation induced by HFD in C57BL/6 mice. Laureane Nunes Masi, Amanda Roque Martins, José César Rosa Neto, Cátia Lira do Amaral, Amanda Rabello Crisma, Marco Aurélio Ramirez Vinolo, Edson Alves de Lima Júnior, Sandro Massao Hirabara, and Rui Curi Copyright © 2012 Laureane Nunes Masi et al. All rights reserved. Role of Vitamin D in Insulin Resistance Mon, 03 Sep 2012 11:23:55 +0000 http://www.hindawi.com/journals/bmri/2012/634195/ Vitamin D is characterized as a regulator of homeostasis of bone and mineral metabolism, but it can also provide nonskeletal actions because vitamin D receptors have been found in various tissues including the brain, prostate, breast, colon, pancreas, and immune cells. Bone metabolism, modulation of the immune response, and regulation of cell proliferation and differentiation are all biological functions of vitamin D. Vitamin D may play an important role in modifying the risk of cardiometabolic outcomes, including diabetes mellitus (DM), hypertension, and cardiovascular disease. The incidence of type 2 DM is increasing worldwide and results from a lack of insulin or inadequate insulin secretion following increases in insulin resistance. Therefore, it has been proposed that vitamin D deficiency plays an important role in insulin resistance resulting in diabetes. The potential role of vitamin D deficiency in insulin resistance has been proposed to be associated with inherited gene polymorphisms including vitamin D-binding protein, vitamin D receptor, and vitamin D 1alpha-hydroxylase gene. Other roles have been proposed to involve immunoregulatory function by activating innate and adaptive immunity and cytokine release, activating inflammation by upregulation of nuclear factor κB and inducing tumor necrosis factor α, and other molecular actions to maintain glucose homeostasis and mediate insulin sensitivity by a low calcium status, obesity, or by elevating serum levels of parathyroid hormone. These effects of vitamin D deficiency, either acting in concert or alone, all serve to increase insulin resistance. Although there is evidence to support a relationship between vitamin D status and insulin resistance, the underlying mechanism requires further exploration. The purpose of this paper was to review the current information available concerning the role of vitamin D in insulin resistance. Chih-Chien Sung, Min-Tser Liao, Kuo-Cheng Lu, and Chia-Chao Wu Copyright © 2012 Chih-Chien Sung et al. All rights reserved. Maternal Moderate Physical Training during Pregnancy Attenuates the Effects of a Low-Protein Diet on the Impaired Secretion of Insulin in Rats: Potential Role for Compensation of Insulin Resistance and Preventing Gestational Diabetes Mellitus Mon, 13 Aug 2012 08:49:05 +0000 http://www.hindawi.com/journals/bmri/2012/805418/ The effects of pregestational and gestational low-to-moderate physical training on insulin secretion in undernourished mothers were evaluated. Virgin female Wistar rats were divided into four groups as follows: control (C, 𝑛=5); trained (T, 𝑛=5); low-protein diet (LP, 𝑛=5); trained with a low-protein diet (T + LP, 𝑛=5). Trained rats ran on a treadmill over a period of 4 weeks before mate (5 days week−1 and 60 min day−1, at 65% of VO2max). At pregnancy, the intensity and duration of the exercise were reduced. Low-protein groups were provided with an 8% casein diet, and controls were provided with a 17% casein diet. At third day after delivery, mothers and pups were killed and islets were isolated by collagenase digestion of pancreas and incubated for a further 1 h with medium containing 5.6 or 16.7 mM glucose. T mothers showed increased insulin secretion by isolated islets incubated with 16.7 mM glucose, whereas LP group showed reduced secretion of insulin by isolated islets when compared with both C and LP + T groups. Physical training before and during pregnancy attenuated the effects of a low-protein diet on the secretion of insulin, suggesting a potential role for compensation of insulin resistance and preventing gestational diabetes mellitus. Carol Góis Leandro, Marco Fidalgo, Adriano Bento-Santos, Filippe Falcão-Tebas, Diogo Vasconcelos, Raul Manhães-de-Castro, Angelo Rafael Carpinelli, Sandro Massao Hirabara, and Rui Curi Copyright © 2012 Carol Góis Leandro et al. All rights reserved. Reactive Oxygen Species in Health and Disease Wed, 08 Aug 2012 11:13:58 +0000 http://www.hindawi.com/journals/bmri/2012/936486/ During the past decades, it became obvious that reactive oxygen species (ROS) exert a multitude of biological effects covering a wide spectrum that ranges from physiological regulatory functions to damaging alterations participating in the pathogenesis of increasing number of diseases. This review summarizes the key roles played by the ROS in both health and disease. ROS are metabolic products arising from various cells; two cellular organelles are intimately involved in their production and metabolism, namely, the endoplasmic reticulum and the mitochondria. Updates on research that tremendously aided in confirming the fundamental roles of both organelles in redox regulation will be discussed as well. Although not comprehensive, this review will provide brief perspective on some of the current research conducted in this area for better understanding of the ROS actions in various conditions of health and disease. Assim A. Alfadda and Reem M. Sallam Copyright © 2012 Assim A. Alfadda and Reem M. Sallam. All rights reserved. Insulin Resistance in Patients with Chronic Kidney Disease Tue, 07 Aug 2012 13:08:23 +0000 http://www.hindawi.com/journals/bmri/2012/691369/ Metabolic syndrome and its components are associated with chronic kidney disease (CKD) development. Insulin resistance (IR) plays a central role in the metabolic syndrome and is associated with increased risk for CKD in nondiabetic patients. IR is common in patients with mild-to-moderate stage CKD, even when the glomerular filtration rate is within the normal range. IR, along with oxidative stress and inflammation, also promotes kidney disease. In patients with end stage renal disease, IR is an independent predictor of cardiovascular disease and is linked to protein energy wasting and malnutrition. Systemic inflammation, oxidative stress, elevated serum adipokines and fetuin-A, metabolic acidosis, vitamin D deficiency, depressed serum erythropoietin, endoplasmic reticulum stress, and suppressors of cytokine signaling all cause IR by suppressing insulin receptor-PI3K-Akt pathways in CKD. In addition to adequate renal replacement therapy and correction of uremia-associated factors, thiazolidinedione, ghrelin, protein restriction, and keto-acid supplementation are therapeutic options. Weight control, reduced daily prednisolone dosage, and the use of cyclosporin decrease the risk of developing new-onset diabetes after kidney transplantation. Improved understanding of the pathogenic mechanisms underlying IR in CKD may lead to more effective therapeutic strategies to reduce uremia-associated morbidity and mortality. Min-Tser Liao, Chih-Chien Sung, Kuo-Chin Hung, Chia-Chao Wu, Lan Lo, and Kuo-Cheng Lu Copyright © 2012 Min-Tser Liao et al. All rights reserved. Treatment with Aqueous Extract from Croton cajucara Benth Reduces Hepatic Oxidative Stress in Streptozotocin-Diabetic Rats Mon, 02 Jul 2012 11:29:42 +0000 http://www.hindawi.com/journals/bmri/2012/902351/ Croton cajucara Benth is a plant found in Amazonia, Brazil and the bark and leaf infusion of this plant have been popularly used to treat diabetes and hepatic disorders. The present study was designed to evaluate the oxidative stress as well as the therapeutic effect of Croton cajucara Benth (1.5 mL of the C. cajucara extract i.g.) in rats with streptozotocin-induced diabetes. Croton cajucara Benth was tested as an aqueous extract for its phytochemical composition, and its antioxidant activity in vitro was also evaluated. Lipid peroxidation and superoxide dismutase, catalase, and glutathione reductase activities were measured in the hepatic tissue, as well as the presence activation of p65 (NF-κB), through western blot. Phytochemical screening of Croton cajucara Benth detected the presence of flavonoids, coumarins and alkaloids. The extract exhibited a significant antioxidant activity in the DPPH-scavenging and the hypoxanthine/xanthine oxidase assays. Liver lipid peroxidation increased in diabetic animals followed by a reduction in the Croton-cajucara-Benth-treated group. There was activation of p65 nuclear expression in the diabetic animals, which was attenuated in the animals receiving the Croton cajucara Benth aqueous extract. The liver tissue in diabetic rats showed oxidative alterations related to the streptozotocin treatment. In conclusion the Croton cajucara Benth aqueus extract treatment effectively reduced the oxidative stress and contributed to tissue recovery. Graziella Ramos Rodrigues, Fábio Cangeri Di Naso, Marilene Porawski, Éder Marcolin, Nélson Alexandre Kretzmann, Alexandre de Barros Falcão Ferraz, Marc Francois Richter, Cláudio Augusto Marroni, and Norma Possa Marroni Copyright © 2012 Graziella Ramos Rodrigues et al. All rights reserved. Association of Polymorphisms in Mitofusin-2 Gene with Type 2 Diabetes in Han Chinese Mon, 18 Jun 2012 14:44:10 +0000 http://www.hindawi.com/journals/bmri/2012/205752/ MFN2 and ESRRA are candidate genes involved in the pathogenesis of T2D. Five tag-SNPs in MFN2 gene and three in ESRRA gene were selected and genotyped with TaqMan or PCR-RFLP method in stage 1 populations (555 patients with T2D and 649 control subjects) and stage 2 populations (546 patients with T2D versus 419 control subjects) in Han Chinese. And combining our published data, we estimated the interactions between genetic variants in the MFN2, ESRRA, and PGC-1α genes on the T2D risk using MDR. rs873458 (𝐺>𝐴) and rs2878677 (𝐶>𝑇) in MFN2 gene were significantly associated with T2D (𝑃=0.005 and 0.01) in stage 1 populations, and the association of other SNPs with T2D was not found. In stage 2 populations, we further confirmed the association between rs2878677 and T2D (𝑃=0.01). Combining the two stage populations, the data supported more significant effect of rs873458 and rs2878677 on T2D risk (𝑃=0.003 and 0.0001). A-C-G-T-C and G-T-C-T-C in MFN2 had significant association with T2D (𝑃=0.007 and 0.009). The present study also provided the evidence that MFN2 had interactions with PGC-1α (𝑃<0.0001) or ESRRA (𝑃<0.0001). This study suggested a role of MFN2 polymorphism in the risk of T2D; however, further studies are needed. Pengtao Li, Shuying Zhu, Xiaopan Wu, Xilin Zhu, Jingyun Li, Liping Pan, Zhenhui Xin, Fenghe Niu, Jia Wu, and Ying Liu Copyright © 2012 Pengtao Li et al. All rights reserved. Molecular Characterization of a Fully Human Chimeric T-Cell Antigen Receptor for Tumor-Associated Antigen EpCAM Tue, 03 Apr 2012 10:11:57 +0000 http://www.hindawi.com/journals/bmri/2012/853879/ The transduction of T cells to express chimeric T-cell antigen receptor (CAR) is an attractive strategy for adaptive immunotherapy for cancer, because the CAR can redirect the recognition specificity of T cells to tumor-associated antigens (TAAs) on the surface of target cells, thereby avoiding the limitations of HLA restriction. However, there are considerable problems with the clinical application of CAR, mostly due to its xenogeneic components, which could be immunogenic in humans. Moreover, while extensive studies on the CARs have been performed, the detailed molecular mechanisms underlying the activation of CAR-grafted T cells remain unclear. In order to eliminate potential immunogenicity and investigate the molecular basis of the CAR-mediated T-cell activation, we constructed a novel CAR (CAR57-28ζ) specific for one of the most important TAAs, epithelial cell adhesion molecule (EpCAM), using only human-derived genes. We revealed that in Jurkat T cells, lentivirally expressed CAR57-28ζ can transmit the T-cell-activating signals sufficient to induce IL-2 production upon EpCAM stimulation. An immunofluorescent analysis clearly showed that the CAR57-28ζ induces the formation of signaling clusters containing endogenous CD3ζ at the CAR/EpCAM interaction interface. These results suggest that this CAR gene may be safely and effectively applied for adaptive T-cell immunotherapy. Naoto Shirasu, Hiromi Yamada, Hirotomo Shibaguchi, Motomu Kuroki, and Masahide Kuroki Copyright © 2012 Naoto Shirasu et al. All rights reserved. Transcription Factor Sp1 Is Involved in Expressional Regulation of Coxsackie and Adenovirus Receptor in Cancer Cells Thu, 24 Nov 2011 18:37:12 +0000 http://www.hindawi.com/journals/bmri/2011/636497/ Coxsackie and adenovirus receptor (CAR) was first known as a virus receptor. Recently, it is also known to have tumor suppressive activity such as inhibition of cell proliferation, migration, and invasion. It is important to understand how CAR expression can be regulated in cancers. Based on an existence of putative Sp1 binding site within CAR promoter, we investigated whether indeed Sp1 is involved in the regulation of CAR expression. We observed that deletion or mutation of Sp1 binding motif (−503/−498) prominently impaired the Sp1 binding affinity and activity of CAR promoter. Histone deacetylase inhibitor (TSA) treatment enhanced recruitment of Sp1 to the CAR promoter in ChIP assay. Meanwhile, Sp1 binding inhibitor suppressed the recruitment. Exogenous expression of wild-type Sp1 increased CAR expression in CAR-negative cells; meanwhile, dominant negative Sp1 decreased the CAR expression in CAR-positive cells. These results indicate that Sp1 is involved in regulation of CAR expression. Sun-Ku Chung, Joo-Young Kim, Joong-Yeon Lim, Young Mi Park, Ha-Young Hwang, Jae-Hwan Nam, and Sang Ick Park Copyright © 2011 Sun-Ku Chung et al. All rights reserved. Possible Linkage of SP6 Transcriptional Activity with Amelogenesis by Protein Stabilization Thu, 20 Oct 2011 15:09:38 +0000 http://www.hindawi.com/journals/bmri/2011/320987/ Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis. Trianna W. Utami, Keiko Miyoshi, Hiroko Hagita, Ryna Dwi Yanuaryska, Taigo Horiguchi, and Takafumi Noma Copyright © 2011 Trianna W. Utami et al. All rights reserved. Expression of Recombinant Human Coagulation Factor VII by the Lizard Leishmania Expression System Thu, 08 Sep 2011 08:48:52 +0000 http://www.hindawi.com/journals/bmri/2011/873874/ The variety of recombinant protein expression systems have been developed as a resource of FVII gene expression. In the current study, the authors used a novel protein expression system based on the Iranian Lizard Leishmania, a trypanosomatid protozoan as a host for expression of FVII. Plasmid containing cDNA encoding full-length human FVII was introduced into Lizard Leishmania and positive transfectants were analyzed by SDS-PAGE and Western blot analysis. Furthermore, biological activity of purified protein was detected by PT assay. The recombinant strain harboring a construct was analyzed for expression of FVII at the mRNA and protein level. Purified rFVII was obtained and in order to confirm the purified compound was in fact rFVII. Western blot analysis was carried out. Clotting time in PT assay was reduced about 30 seconds with the purified rFVII. In Conclusion, this study has demonstrated, for the first time, that Leishmania cells can be used as an expression system for producing recombinant FVII. Sina Mirzaahmadi, Golnaz Asaadi-Tehrani, Mojgan Bandehpour, Nooshin Davoudi, Leila Tahmasbi, Nahid Hosseinzadeh, Hasan Mirzahoseini, Kazem Parivar, and Bahram Kazemi Copyright © 2011 Sina Mirzaahmadi et al. All rights reserved. Development of a Single-Step Subtraction Method for Eukaryotic 18S and 28S Ribonucleic Acids Sat, 25 Jun 2011 01:47:28 +0000 http://www.hindawi.com/journals/bmri/2011/910369/ The abundance of mammalian 18S and 28S ribosomal RNA can decrease the detection sensitivity of bacterial or viral targets in complex host-pathogen mixtures. A method to capture human RNA in a single step was developed and characterized to address this issue. For this purpose, capture probes were covalently attached to magnetic microbeads using a dendrimer linker and the solid phase was tested using rat thymus RNA (mammalian components) with Escherichia coli RNA (bacterial target) as a model system. Our results indicated that random capture probes demonstrated better performance than specific ones presumably by increasing the number of possible binding sites, and the use of a tetrame-thylammonium-chloride (TMA-Cl-) based buffer for the hybridization showed a beneficial effect in the selectivity. The subtraction efficiency determined through real-time RT-PCR revealed capture-efficiencies comparable with commercially available enrichment kits. The performance of the solid phase can be further fine tuned by modifying the annealing time and temperature. Marie J. Archer and Baochuan Lin Copyright © 2011 Marie J. Archer and Baochuan Lin. All rights reserved. The Epithelium—Molecular Landscaping for an Interactive Barrier Mon, 28 Mar 2011 11:43:47 +0000 http://www.hindawi.com/journals/bmri/2010/870506/ Karl Chai, Kenichiro Kitamura, Amanda McCann, and Xue-Ru Wu Copyright © 2010 Karl Chai et al. All rights reserved. Biomolecular Interaction Study of Cyclolinopeptide A with Human Serum Albumin Wed, 09 Mar 2011 16:39:41 +0000 http://www.hindawi.com/journals/bmri/2010/737289/ The kinetics, energetics, and structure of Cyclolinopeptide A binding with Human Serum Albumin were investigated with surface plasmon resonance and circular dichroism. The complex is formed through slow recognition kinetics that is temperature sensitive in the range of 20°C–37°C. The overall reaction was observed to be endothermic ( kJ ) and entropy driven ( J ) with overall small changes to the tertiary structure. Ben Rempel, Bo Gui, Jason Maley, Martin Reaney, and Ramaswami Sammynaiken Copyright © 2010 Ben Rempel et al. All rights reserved. BAC Libraries from Wheat Chromosome 7D: Efficient Tool for Positional Cloning of Aphid Resistance Genes Thu, 23 Dec 2010 10:49:07 +0000 http://www.hindawi.com/journals/bmri/2011/302543/ Positional cloning in bread wheat is a tedious task due to its huge genome size and hexaploid character. BAC libraries represent an essential tool for positional cloning. However, wheat BAC libraries comprise more than million clones, which makes their screening very laborious. Here, we present a targeted approach based on chromosome-specific BAC libraries. Such libraries were constructed from flow-sorted arms of wheat chromosome 7D. A library from the short arm (7DS) consisting of 49,152 clones with 113 kb insert size represented 12.1 arm equivalents whereas a library from the long arm (7DL) comprised 50,304 clones of 116 kb providing 14.9x arm coverage. The 7DS library was PCR screened with markers linked to Russian wheat aphid resistance gene DnCI2401, the 7DL library was screened by hybridization with a probe linked to greenbug resistance gene Gb3. The small number of clones combined with high coverage made the screening highly efficient and cost effective. Hana Šimková, Jan Šafár, Marie Kubaláková, Pavla Suchánková, Jarmila Cíhalíková, Heda Robert-Quatre, Perumal Azhaguvel, Yiqun Weng, Junhua Peng, Nora L.V. Lapitan, Yaqin Ma, Frank M. You, Ming-Cheng Luo, Jan Bartoš, and Jaroslav Doležel Copyright © 2011 Hana Šimková et al. All rights reserved. BAC Modification through Serial or Simultaneous Use of CRE/Lox Technology Sun, 19 Dec 2010 13:03:37 +0000 http://www.hindawi.com/journals/bmri/2011/924068/ Bacterial Artificial Chromosomes (BACs) are vital tools in mouse genomic analyses because of their ability to propagate large inserts. The size of these constructs, however, prevents the use of conventional molecular biology techniques for modification and manipulation. Techniques such as recombineering and Cre/Lox methodologies have thus become heavily relied upon for such purposes. In this work, we investigate the applicability of Lox variant sites for serial and/or simultaneous manipulations of BACs. We show that Lox spacer mutants are very specific, and inverted repeat variants reduce Lox reaction rates through reducing the affinity of Cre for the site, while retaining some functionality. Employing these methods, we produced serial modifications encompassing four independent changes which generated a mouse HoxB BAC with fluorescent reporter proteins inserted into four adjacent Hox genes. We also generated specific, simultaneous deletions using combinations of spacer variants and inverted repeat variants. These techniques will facilitate BAC manipulations and open a new repertoire of methods for BAC and genome manipulation. Mark Parrish, Jay Unruh, and Robb Krumlauf Copyright © 2011 Mark Parrish et al. All rights reserved. Construction and Characterization of an Infectious Murine Gammaherpesivrus-68 Bacterial Artificial Chromosome Thu, 09 Dec 2010 13:24:17 +0000 http://www.hindawi.com/journals/bmri/2011/926258/ Here we describe the cloning of a sequenced WUMS isolate of murine gammaherpesvirus-68 (MHV-68, γHV-68, also known as MuHV-4) as a bacterial artificial chromosome (BAC). We engineered the insertion of the BAC sequence flanked by loxP sites into the left end of the viral genome before the M1 open reading frame. The infectious viruses were reconstituted following transfection of the MHV-68 BAC DNA into cells. The MHV-68 BAC-derived virus replicated indistinguishably from the wild-type virus in cultured cells. Excision of the BAC insert was efficiently achieved by coexpressing the Cre recombinase. Although the BAC insertion did not significantly affect acute productive infection in the lung, it severely compromised the ability of MHV-68 to establish splenic latency. Removal of the BAC sequence restored the wild-type level of latency. Site-specific mutagenesis was carried out by RecA-mediated recombination to demonstrate that this infectious BAC clone can be used for genetic studies of MHV-68. Ting-Ting Wu, Hsiang-I Liao, Leming Tong, Ronika Sitapara Leang, Greg Smith, and Ren Sun Copyright © 2011 Ting-Ting Wu et al. All rights reserved. Molecular and Therapeutic Potential and Toxicity of Valproic Acid Thu, 29 Jul 2010 15:29:08 +0000 http://www.hindawi.com/journals/bmri/2010/479364/ Valproic acid (VPA), a branched short-chain fatty acid, is widely used as an antiepileptic drug and a mood stabilizer. Antiepileptic properties have been attributed to inhibition of Gamma Amino Butyrate (GABA) transaminobutyrate and of ion channels. VPA was recently classified among the Histone Deacetylase Inhibitors, acting directly at the level of gene transcription by inhibiting histone deacetylation and making transcription sites more accessible. VPA is a widely used drug, particularly for children suffering from epilepsy. Due to the increasing number of clinical trials involving VPA, and interesting results obtained, this molecule will be implicated in an increasing number of therapies. However side effects of VPA are substantially described in the literature whereas they are poorly discussed in articles focusing on its therapeutic use. This paper aims to give an overview of the different clinical-trials involving VPA and its side effects encountered during treatment as well as its molecular properties. Sébastien Chateauvieux, Franck Morceau, Mario Dicato, and Marc Diederich Copyright © 2010 Sébastien Chateauvieux et al. All rights reserved. Small Deletion at the 7q21.2 Locus in a CCM Family Detected by Real-Time Quantitative PCR Tue, 27 Jul 2010 15:50:15 +0000 http://www.hindawi.com/journals/bmri/2010/854737/ Cerebral cavernous malformations (CCMs) represent a common autosomal dominant disorder that predisposes patients to haemorrhagic strokes and focal neurological signs. About 56% of the hereditary forms of CCMs have been so far associated with mutations in the KRIT1 (Krev Interaction Trapped 1) gene, located at 7q21.2 (CCM1 locus). We described the complete loss of 7q21.2 locus encompassing the KRIT1 gene and 4 flanking genes in a CCM family by using a dense set of 12 microsatellite markers. The complete loss of the maternal copy of KRIT1 gene region was confirmed by Real-Time Quantitative Polymerase Chain Reaction (RT-QPCR) and the same approach was used for expression analysis. Additional RT-QPCR analysis showed the extension of the deletion, for a total of 700 kb, to the adjacent downstream and upstream-located genes, MTERF, AKAP9, CYP51A1, as well as a partial loss of the ANKIB1 gene. Here we report the molecular characterization of an interstitial small genomic deletion of the 7q21.2 region in a CCMs affected family, encompassing the KRIT1 gene. Our findings confirm the loss of function mechanism for the already known CCM1 locus, without any evident involvement of the other deleted genes. Moreover, our investigations highlight the usefulness of the RT-QPCR to the molecular characterization of the breakpoints genomic deletions and to the identification of internal deleted genes involved in the human genetic diseases. Lucia Anna Muscarella, Vito Guarnieri, Michelina Coco, Serena Belli, Paola Parrella, Giuseppe Pulcrano, Domenico Catapano, Vincenzo A. D'Angelo, Leopoldo Zelante, and Leonardo D'Agruma Copyright © 2010 Lucia Anna Muscarella et al. All rights reserved. Novel Method of Cell-Free In Vitro Synthesis of the Human Fibroblast Growth Factor 1 Gene Tue, 20 Jul 2010 16:35:22 +0000 http://www.hindawi.com/journals/bmri/2010/971340/ Recombinant DNA projects generally involve cell-based gene cloning. However, because template DNA is not always readily available, in vitro chemical synthesis of complete genes from DNA oligonucleotides is becoming the preferred method for cloning. This article describes a new, rapid procedure based on Taq polymerase for the precise assembly of DNA oligonucleotides to yield the complete human fibroblast growth factor 1 (FGF1) gene, which is 468 bp long and has a G+C content of 51.5%. The new method involved two steps: (1) the design of the DNA oligonucleotides to be assembled and (2) the assembly of multiple oligonucleotides by PCR to generate the whole FGF1 gene. The procedure lasted a total of only 2 days, compared with 2 weeks for the conventional procedure. This method of gene synthesis is expected to facilitate various kinds of complex genetic engineering projects that require rapid gene amplification, such as cell-free whole-DNA library construction, as well as the construction of new genes or genes that contain any mutation, restriction site, or DNA tag. Peijun Zuo and A. Bakr M. Rabie Copyright © 2010 Peijun Zuo and A. Bakr M. Rabie. All rights reserved. Assessment of DNA Damage by RAPD in Paracentrotus lividus Embryos Exposed to Amniotic Fluid from Residents Living Close to Waste Landfill Sites Sun, 11 Jul 2010 15:22:40 +0000 http://www.hindawi.com/journals/bmri/2010/251767/ The aim of this study was to assess the genotoxic effects of environmental chemicals on residents living near landfills. The study was based on samples of amniotic fluid from women living in the intensely polluted areas around the Campania region of Italy compared to a nonexposed control group. We evaluated the genetic effects that this amniotic fluids collected in contaminated sites had on Paracentrotus lividus embryos. DNA damage was detected through changes in RAPD (Random Amplified Polymorphism DNA) profiles. The absence of the amplified DNA fragments indicated deletions in Paracentrotus lividus DNA exposed to the contaminated amniotic fluids when compared to equal exposure to uncontaminated fluids. These results show the ability of RAPD-PCR to detect and isolate DNA sequences representing genetic alterations induced in P. lividus embryos. Using this method, we identified two candidate target regions for DNA alterations in the genome of P. lividus. Our research indicates that RAPD-PCR in P. lividus embryo DNA can provide a molecular approach for studying DNA damage from pollutants that can impact human health. To our knowledge, this is the first time that assessment of DNA damage in P. lividus embryos has been tested using the RAPD strategy after exposure to amniotic fluid from residents near waste landfill sites. Maurizio Guida, Marco Guida, Bruna De Felice, Daniela Santafede, Raffaella D'Alessandro, Attilio Di Spiezio Sardo, Marianna Scognamiglio, Cinzia Ferrara, Giuseppe Bifulco, and Carmine Nappi Copyright © 2010 Maurizio Guida et al. All rights reserved. Multiple-Locus Variable-Number Tandem Repeat Analysis of Vibrio cholerae in Comparison with Pulsed Field Gel Electrophoresis and Virulotyping Wed, 30 Jun 2010 12:19:37 +0000 http://www.hindawi.com/journals/bmri/2010/817190/ Molecular analysis of Malaysian Vibrio cholerae was carried out using a multiple-locus variable-number tandem repeat analysis (MLVA) assay based on 7 loci of V. cholerae. The discriminatory ability of the assay was compared with pulsed-field gel electrophoresis (PFGE) using 43 Malaysian V. cholerae isolated from various sources. In addition, the virulotypes of the strains were determined. Based on MLVA, 38 allelic profiles were obtained (F=0.63) while PFGE generated 35 pulsotypes (F=0.71). Simpson's index of diversity for different VNTR loci ranged from 0.59 to 0.92. The combined loci increased the discriminatory index to 0.99 which was comparable with PFGE (D=0.99). Most of the environmental non-O1/non-O139 strains harbored rtxA, rstR, toxR, and hlyA only, and the virulotype of this serogroup was significantly different (𝑃<.01) from clinical/environmental O1 and environmental O139 strains. In conclusion, the MLVA assay developed in this study was a useful genotyping tool with comparable discriminatory power with PFGE. In addition, the combination of the two approaches can further distinguish the strains from different sources and geographical regions of isolation. Cindy Shuan Ju Teh, Kek Heng Chua, and Kwai Lin Thong Copyright © 2010 Cindy Shuan Ju Teh et al. All rights reserved. A Comprehensive In Silico Analysis of the Functional and Structural Impact of SNPs in the IGF1R Gene Wed, 23 Jun 2010 15:49:38 +0000 http://www.hindawi.com/journals/bmri/2010/715139/ Insulin-like growth factor 1 receptor (IGF1R) acts as a critical mediator of cell proliferation and survival. Many single nucleotide polymorphisms (SNPs) found in the IGF1R gene have been associated with various diseases, including both breast and prostate cancer. The genetics of these diseases could be better understood by knowing the functions of these SNPs. In this study, we performed a comprehensive analysis of the functional and structural impact of all known SNPs in this gene using publicly available computational prediction tools. Out of a total of 2412 SNPs in IGF1R retrieved from dbSNP, we found 32 nsSNPs, 58 sSNPs, 83 mRNA 3 UTR SNPs, and 2225 intronic SNPs. Among the nsSNPs, a total of six missense nsSNPs were found to be damaging by both a sequence homology-based tool (SIFT) and a structural homology-based method (PolyPhen), and one nonsense nsSNP was found. Further, we modeled mutant proteins and compared the total energy values with the native IGF1R protein, and showed that a mutation from arginine to cysteine at position 1216 (rs61740868) on the surface of the protein caused the greatest impact on stability. Also, the FASTSNP tool suggested that 31 sSNPs and 3 intronic SNPs might affect splicing regulation. Based on our investigation, we report potential candidate SNPs for future studies on IGF1R mutations. S. A. de Alencar and Julio C. D. Lopes Copyright © 2010 S. A. de Alencar and Julio C. D. Lopes. All rights reserved. Impact of Lentiviral Vector-Mediated Transduction on the Tightness of a Polarized Model of Airway Epithelium and Effect of Cationic Polymer Polyethylenimine Mon, 21 Jun 2010 13:31:31 +0000 http://www.hindawi.com/journals/bmri/2010/103976/ Lentiviral (LV) vectors are promising agents for efficient and long-lasting gene transfer into the lung and for gene therapy of genetically determined pulmonary diseases, such as cystic fibrosis, however, they have not been evaluated for cytotoxicity and impact on the tightness of the airway epithelium. In this study, we evaluated the transduction efficiency of a last-generation LV vector bearing Green Fluorescent Protein (GFP) gene as well as cytotoxicity and tight junction (TJ) integrity in a polarized model of airway epithelial cells. High multiplicities of infection (MOI) showed to be cytotoxic, as assessed by increase in propidium iodide staining and decrease in cell viability, and harmful for the epithelial tightness, as demonstrated by the decrease of transepithelial resistance (TER) and delocalization of occludin from the TJs. To increase LV efficiency at low LV:cell ratio, we employed noncovalent association with the polycation branched 25 kDa polyethylenimine (PEI). Transduction of cells with PEI/LV particles resulted in 2.5–3.6-fold increase of percentage of GFP-positive cells only at the highest PEI:LV ratios ( PEI molecules/transducing units with 50 MOI LV) as compared to plain LV. At this dose PEI/LV transduction resulted in % of propidium iodide-positive cells. On the other hand, PEI/LV particles did not determine any alteration of TER and occludin localization. We conclude that PEI may be useful for improving the efficiency of gene transfer mediated by LV vectors in airway epithelial cells, in the absence of high acute cytotoxicity and alteration in epithelial tightness. Stefano Castellani, Sante Di Gioia, Teresa Trotta, Angela Bruna Maffione, and Massimo Conese Copyright © 2010 Stefano Castellani et al. All rights reserved. Claudin 1 in Breast Tumorigenesis: Revelation of a Possible Novel “Claudin High” Subset of Breast Cancers Thu, 13 May 2010 14:41:50 +0000 http://www.hindawi.com/journals/bmri/2010/956897/ Claudins are the major component of the tight junctions in epithelial cells and as such play a key role in the polarized location of ion channels, receptors, and enzymes to the different membrane domains. In that regard, claudins are necessary for the harmonious development of a functional epithelium. Moreover, defective tight junctions have been associated with the development of neoplastic phenotype in epithelial cells. Breakdown of cell-cell interactions and deregulation of the expression of junctional proteins are therefore believed to be key steps in invasion and metastasis. Several studies suggest that the claudins are major participants in breast tumorigenesis. In this paper, we discuss recent advances in our understanding of the potential role of claudin 1 in breast cancer. We also discuss the significance of a subset of estrogen receptor negative breast cancers which express “high” levels of the claudin 1 protein. We propose that claudin 1 functions both as a tumor suppressor as well as a tumor enhancer/facilitator in breast cancer. Yvonne Myal, Etienne Leygue, and Anne A. Blanchard Copyright © 2010 Yvonne Myal et al. All rights reserved. TNF𝛼 Induces Choroid Plexus Epithelial Cell Barrier Alterations by Apoptotic and Nonapoptotic Mechanisms Tue, 30 Mar 2010 11:42:13 +0000 http://www.hindawi.com/journals/bmri/2010/307231/ The choroid plexus epithelium constitutes the structural basis of the blood-cerebrospinal fluid barrier. Since the cytokine TNF𝛼 is markedly increased during inflammatory diseases in the blood and the central nervous system, we investigated by which mechanisms TNF𝛼 induces barrier alteration in porcine choroid plexus epithelial cells. We found a dose-dependent decrease of transepithelial electrical resistance, increase of paracellular inulin-flux, and induction of histone-associated DNA fragmentation and caspase-3 activation after TNF𝛼 stimulation. This response was strongly aggravated by the addition of cycloheximide and could partially be inhibited by the NF-𝜅B inhibitor CAPE, but most effectively by the pan-caspase-inhibitor zVAD-fmk and not by the JNK inhibitor SP600125. Partial loss of cell viability could also be attenuated by CAPE. Immunostaining showed cell condensation and nuclear binding of high-mobility group box 1 protein as a sign of apoptosis after TNF𝛼 stimulation. Taken together our findings indicate that TNF𝛼 compromises PCPEC barrier function by caspase and NF-𝜅B dependent mechanisms. Christian Schwerk, Kasia Rybarczyk, Frank Essmann, Annette Seibt, Marie-Louise Mölleken, Patrick Zeni, Horst Schroten, and Tobias Tenenbaum Copyright © 2010 Christian Schwerk et al. All rights reserved. Gelsolin Restores A𝛽-Induced Alterations in Choroid Plexus Epithelium Thu, 25 Mar 2010 14:55:50 +0000 http://www.hindawi.com/journals/bmri/2010/805405/ Histologically, Alzheimer's disease (AD) is characterized by senile plaques and cerebrovascular amyloid deposits. In previous studies we demonstrated that in AD patients, amyloid-𝛽 (A𝛽) peptide also accumulates in choroid plexus, and that this process is associated with mitochondrial dysfunction and epithelial cell death. However, the molecular mechanisms underlying A𝛽 accumulation at the choroid plexus epithelium remain unclear. A𝛽 clearance, from the brain to the blood, involves A𝛽 carrier proteins that bind to megalin, including gelsolin, a protein produced specifically by the choroid plexus epithelial cells. In this study, we show that treatment with gelsolin reduces A𝛽-induced cytoskeletal disruption of blood-cerebrospinal fluid (CSF) barrier at the choroid plexus. Additionally, our results demonstrate that gelsolin plays an important role in decreasing A𝛽-induced cytotoxicity by inhibiting nitric oxide production and apoptotic mitochondrial changes. Taken together, these findings make gelsolin an appealing tool for the prophylactic treatment of AD. Teo Vargas, Desiree Antequera, Cristina Ugalde, Carlos Spuch, and Eva Carro Copyright © 2010 Teo Vargas et al. All rights reserved. The Chick Chorioallantoic Membrane: A Model of Molecular, Structural, and Functional Adaptation to Transepithelial Ion Transport and Barrier Function during Embryonic Development Sun, 21 Mar 2010 14:59:22 +0000 http://www.hindawi.com/journals/bmri/2010/940741/ The chick chorioallantoic membrane is a very simple extraembryonic membrane which serves multiple functions during embryo development; it is the site of exchange of respiratory gases, calcium transport from the eggshell, acid-base homeostasis in the embryo, and ion and H2O reabsorption from the allantoic fluid. All these functions are accomplished by its epithelia, the chorionic and the allantoic epithelium, by differentiation of a wide range of structural and molecular peculiarities which make them highly specialized, ion transporting epithelia. Studying the different aspects of such a developmental strategy emphasizes the functional potential of the epithelium and offers an excellent model system to gain insights into questions partly still unresolved. Maria Gabriella Gabrielli and Daniela Accili Copyright © 2010 Maria Gabriella Gabrielli and Daniela Accili. All rights reserved. Volume Density, Distribution, and Ultrastructure of Secretory and Basolateral Membranes and Mitochondria Predict Parietal Cell Secretory (Dys)function Thu, 18 Mar 2010 13:50:40 +0000 http://www.hindawi.com/journals/bmri/2010/394198/ Acid secretion in gastric parietal cells requires highly coordinated membrane transport and vesicle trafficking. Histologically, consensus defines acid secretion as the ratio of the volume density (Vd) of canalicular and apical membranes (CAMs) to tubulovesicular (TV) membranes, a value which varies widely under normal conditions. Examination of numerous achlorhydric mice made it clear that this paradigm is discrepant when used to assess most mice with genetic mutations affecting acid secretion. Vd of organelles in parietal cells of 6 genetically engineered mouse strains was obtained to identify a stable histological phenotype of acid secretion. We confirmed that CAM to TV ratio fairly represented secretory activity in untreated and secretion-inhibited wild-type (WT) mice and in NHE2−/− mice as well, though the response was significantly attenuated in the latter. However, high CAM to TV ratios wrongly posed as active acid secretion in AE2−/−, GHKA𝛼−/−, and NHE4−/− mice. Achlorhydric genotypes also had a significantly higher Vd of basolateral membrane than WT mice, and reduced Vd of mitochondria and canaliculi. The Vd of mitochondria, and ratio of the Vd of basolateral membranes/Vd of mitochondria were preferred predictors of the level of acid secretion. Alterations in acid secretion, then, cause significant changes not only in the Vd of secretory membranes but also in mitochondria and basolateral membranes. Marian L. Miller, Anastasia Andringa, Yana Zavros, Emily M. Bradford, and Gary E. Shull Copyright © 2010 Marian L. Miller et al. All rights reserved. Regulation of P-Glycoprotein in Renal Proximal Tubule Epithelial Cells by LPS and TNF-α Tue, 09 Mar 2010 13:35:42 +0000 http://www.hindawi.com/journals/bmri/2010/525180/ During endotoxemia, the ATP-dependent drug efflux pump P-glycoprotein (Abcb1/P-gp) is upregulated in kidney proximal tubule epithelial cells. The signaling pathway through which lipopolysaccharide (LPS) or tumor necrosis factor-𝛼 (TNF-𝛼) regulates P-gp expression and activity was investigated further in the present study. Exposure of rat kidney proximal tubule cells to TNF-𝛼 alone or TNF-𝛼 and LPS increased P-gp gene and protein expression levels and efflux activity, suggesting de novo P-gp synthesis. Upon exposure to TNF-𝛼 in combination with LPS, P-gp activity in renal proximal tubule cells is increased under influence of nitric oxide (NO) produced by inducible NO synthase. Upon exposure to TNF-𝛼 alone, P-gp upregulation seems to involve TLR4 activation and nuclear factor kappaB (NF-𝜅B) translocation, a pathway that is likely independent of NO. These findings indicate that at least two pathways regulate P-gp expression in the kidney during endotoxemia. Suzanne Heemskerk, Janny G. P. Peters, Jochem Louisse, Seil Sagar, Frans G. M. Russel, and Rosalinde Masereeuw Copyright © 2010 Suzanne Heemskerk et al. All rights reserved. The Dual Role of Zonula Occludens (ZO) Proteins Tue, 09 Mar 2010 11:11:01 +0000 http://www.hindawi.com/journals/bmri/2010/402593/ ZO (zonula occludens) proteins are scaffolding proteins providing the structural basis for the assembly of multiprotein complexes at the cytoplasmic surface of intercellular junctions. In addition, they provide a link between the integral membrane proteins and the filamentous cytoskeleton. ZO proteins belong to the large family of membrane-associated guanylate kinase (MAGUK)-like proteins comprising a number of subfamilies based on domain content and sequence similarity. Besides their structural function at cell-cell contacts, ZO proteins appear to participate in the regulation of cell growth and proliferation. Detailed molecular studies have shown that ZO proteins exhibit conserved functional nuclear localization and nuclear export motifs within their amino acid sequence. Further, ZO proteins interact with dual residency proteins localizing to the plasma membrane and the nucleus. Although the nuclear targeting of ZO proteins has well been described, many questions concerning the biological significance of this process have remained open. This review focuses on the dual role of ZO proteins, being indispensable structural components at the junctional site and functioning in signal transduction pathways related to gene expression and cell behavior. H. Bauer, J. Zweimueller-Mayer, P. Steinbacher, A. Lametschwandtner, and H. C. Bauer Copyright © 2010 H. Bauer et al. All rights reserved. Neutrophils Compromise Retinal Pigment Epithelial Barrier Integrity Wed, 03 Mar 2010 14:42:10 +0000 http://www.hindawi.com/journals/bmri/2010/289360/ We hypothesized that neutrophils and their secreted factors mediate breakdown of the integrity of the outer blood-retina-barrier by degrading the apical tight junctions of the retinal pigment epithelium (RPE). The effect of activated neutrophils or neutrophil cell lysate on apparent permeability of bovine RPE-Choroid explants was evaluated by measuring mannitol flux in a modified Ussing chamber. The expression of matrix metalloproteinase- (MMP-) 9 in murine peritoneal neutrophils, and the effects of neutrophils on RPE tight-junction protein expression were assessed by confocal microscopy and western blot. Our results revealed that basolateral incubation of explants with neutrophils decreased occludin and ZO-1 expression at 1 and 3 hours and increased the permeability of bovine RPE-Choroid explants by >3-fold (). Similarly, basolateral incubation of explants with neutrophil lysate decreased ZO-1 expression at 1 and 3 hours () and increased permeability of explants by 75%. Further, we found that neutrophils prominently express MMP-9 and that incubation of explants with neutrophils in the presence of anti-MMP-9 antibody inhibited the increase in permeability. These data suggest that neutrophil-derived MMP-9 may play an important role in disrupting the integrity of the outer blood-retina barrier. Jiehao Zhou, Shikun He, Ning Zhang, Christine Spee, Peng Zhou, Stephen J. Ryan, Ram Kannan, and David R. Hinton Copyright © 2010 Jiehao Zhou et al. All rights reserved. Regulation of Adrenal Aldosterone Production by Serine Protease Prostasin Tue, 02 Mar 2010 16:02:42 +0000 http://www.hindawi.com/journals/bmri/2010/793843/ A serine protease prostasin has been demonstrated to have a pivotal role in the activation of the epithelial sodium channel. Systemic administration of adenovirus carrying human prostasin gene in rats resulted in an increase in plasma prostasin and aldosterone levels. However, the mechanism by which the elevation of prostasin levels in the systemic circulation stimulated the plasma aldosterone levels remains unknown. Therefore, we examined if prostasin increases the aldosterone synthesis in a human adrenocortical cell line (H295R cells). Luciferase assay using CYP11B2 promoter revealed that prostasin significantly increased the transcriptional activity of CYP11B2. Prostasin significantly increased both CYP11B2 mRNA expression and aldosterone production in a dose-dependent manner. Surprisingly, treatment with camostat mesilate, a potent prostasin inhibitor, had no effect on the aldosterone synthesis by prostasin and also a protease-dead mutant of prostasin significantly stimulated the aldosterone production. A T-type/L-type calcium channel blocker and a protein kinase C (PKC) inhibitor significantly reduced the aldosterone synthesis by prostasin. Our findings suggest a stimulatory effect of prostasin on the aldosterone synthesis by adrenal gland through the nonproteolytic action and indicate a new role of prostasin in the systemic circulation. Takehiro Ko, Yutaka Kakizoe, Naoki Wakida, Manabu Hayata, Kohei Uchimura, Naoki Shiraishi, Taku Miyoshi, Masataka Adachi, Shizuka Aritomi, Tomoyuki Konda, Kimio Tomita, and Kenichiro Kitamura Copyright © 2010 Takehiro Ko et al. All rights reserved. A Novel Method for High-Level Production of TEV Protease by Superfolder GFP Tag Tue, 23 Feb 2010 13:26:09 +0000 http://www.hindawi.com/journals/bmri/2009/591923/ Because of its stringent sequence specificity, tobacco etch virus (TEV) protease is widely used to remove fusion tags from recombinant proteins. Due to the poor solubility of TEV protease, many strategies have been employed to increase the expression level of this enzyme. In our work, we introduced a novel method to produce TEV protease by using visible superfolder green fluorescent protein (sfGFP) as the fusion tag. The soluble production and catalytic activity of six variants of sfGFP-TEV was examined, and then the best variant was selected for large-scale production. After purified by Ni-NTA affinity chromatography and Q anion exchange chromatography, the best variant of sfGFP-TEV fusion protease was obtained with purity of over 98% and yield of over 320 mg per liter culture. The sfGFP-TEV had a similar catalytic activity to that of the original TEV protease. Our research showed a novel method of large-scale production of visible and functional TEV protease for structural genomics research and other applications. Xudong Wu, Di Wu, Zhisheng Lu, Wentao Chen, Xiaojian Hu, and Yu Ding Copyright © 2009 Xudong Wu et al. All rights reserved. Tight Junctions in Salivary Epithelium Thu, 18 Feb 2010 15:30:00 +0000 http://www.hindawi.com/journals/bmri/2010/278948/ Epithelial cell tight junctions (TJs) consist of a narrow belt-like structure in the apical region of the lateral plasma membrane that circumferentially binds each cell to its neighbor. TJs are found in tissues that are involved in polarized secretions, absorption functions, and maintaining barriers between blood and interstitial fluids. The morphology, permeability, and ion selectivity of TJ vary among different types of tissues and species. TJs are very dynamic structures that assemble, grow, reorganize, and disassemble during physiological or pathological events. Several studies have indicated the active role of TJ in intestinal, renal, and airway epithelial function; however, the functional significance of TJ in salivary gland epithelium is poorly understood. Interactions between different combinations of the TJ family (each with their own unique regulatory proteins) define tissue specificity and functions during physiopathological processes; however, these interaction patterns have not been studied in salivary glands. The purpose of this review is to analyze some of the current data regarding the regulatory components of the TJ that could potentially affect cellular functions of the salivary epithelium. Olga J. Baker Copyright © 2010 Olga J. Baker. All rights reserved. The Retinal Pigment Epithelium: Something More than a Constituent of the Blood-Retinal Barrier—Implications for the Pathogenesis of Diabetic Retinopathy Wed, 17 Feb 2010 14:02:41 +0000 http://www.hindawi.com/journals/bmri/2010/190724/ The retinal pigment epithelium (RPE) is an specialized epithelium lying in the interface between the neural retina and the choriocapillaris where it forms the outer blood-retinal barrier (BRB). The main functions of the RPE are the following: (1) transport of nutrients, ions, and water, (2) absorption of light and protection against photooxidation, (3) reisomerization of all-trans-retinal into 11-cis-retinal, which is crucial for the visual cycle, (4) phagocytosis of shed photoreceptor membranes, and (5) secretion of essential factors for the structural integrity of the retina. An overview of these functions will be given. Most of the research on the physiopathology of diabetic retinopathy has been focused on the impairment of the neuroretina and the breakdown of the inner BRB. By contrast, the effects of diabetes on the RPE and in particular on its secretory activity have received less attention. In this regard, new therapeutic strategies addressed to modulating RPE impairment are warranted. Rafael Simó, Marta Villarroel, Lídia Corraliza, Cristina Hernández, and Marta Garcia-Ramírez Copyright © 2010 Rafael Simó et al. All rights reserved. Interaction of Botulinum Toxin with the Epithelial Barrier Sun, 14 Feb 2010 14:06:32 +0000 http://www.hindawi.com/journals/bmri/2010/974943/ Botulinum neurotoxin (BoNT) is a protein toxin (~150 kDa), which possesses a metalloprotease activity. Food-borne botulism is manifested when BoNT is absorbed from the digestive tract to the blood stream and enters the peripheral nerves, where the toxin cleaves core proteins of the neuroexocytosis apparatus and elicits the inhibition of neurotransmitter release. The initial obstacle to orally ingested BoNT entering the body is the epithelial barrier of the digestive tract. Recent cell biology and molecular biology studies are beginning to elucidate the mechanism by which this large protein toxin crosses the epithelial barrier. In this review, we provide an overview of the structural features of botulinum toxins (BoNT and BoNT complex) and the interaction of these toxins with the epithelial barrier. Yukako Fujinaga Copyright © 2010 Yukako Fujinaga. All rights reserved. A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells Thu, 04 Feb 2010 08:24:07 +0000 http://www.hindawi.com/journals/bmri/2009/104716/ MicroRNAs (miRNAs) downregulate gene expression by binding to the partially complementary sites in the untranslated region (UTR) of target mRNAs. Several methods, such as Northern blot analysis, quantitative real-time RT-PCR, microarray, and the luciferase reporter system, are commonly used to quantify the relative level or activity of miRNAs. The disadvantage of these methods is the requirement for cell lysis, which means that several sets of wells/dishes of cells must be prepared to monitor changes in miRNA activity in time-course studies. In this study, we developed a multisampling reporter system in which two secretable bioluminescence-generating enzymes are employed, one as a reporter and the other as an internal control. The reporters consist of a pair of vectors containing the Metridia luciferase gene, one with and one without a duplicated miRNA targeting sequence at their UTR, while the other vector coding for the secreted alkaline phosphatase gene is used as an internal control. This method allows miRNA activity to be monitored within the same population of cells over time by withdrawing aliquots of the culture medium. The practicability and benefits of this system are addressed in this report. Pei-Chen Huang, Chih-Ying Chen, Feng-Yuan Yang, and Lo-Chun Au Copyright © 2009 Pei-Chen Huang et al. All rights reserved. Molecular Modulation of Intestinal Epithelial Barrier: Contribution of Microbiota Sun, 31 Jan 2010 10:43:42 +0000 http://www.hindawi.com/journals/bmri/2010/305879/ The daunting task required of the gut-barrier to prevent luminal pathogens and harmful substances from entering into the internal milieu and yet promoting digestion and absorption of nutrients requires an exquisite degree of coordination between the different architectural units of this barrier. The complex integration and execution of these functions are superbly carried out by the intestinal mucosal (IM) surface. Exposed to trillions of luminal microbes, the IM averts threats by signaling to the innate immune system, through pattern recognition receptors (PRR), to respond to the commensal bacteria by developing tolerance (hyporesponsiveness) towards them. This system also acts by protecting against pathogens by elaborating and releasing protective peptides, cytokines, chemokines, and phagocytic cells. The IM is constantly sampling luminal contents and making molecular adjustments at its frontier. This article describes the topography of the IM and the mechanisms of molecular adjustments that protect the internal milieu, and also describes the role of the microbiota in achieving this goal. Renu Sharma, Christopher Young, and Josef Neu Copyright © 2010 Renu Sharma et al. All rights reserved. Receptor-Mediated and Fluid-Phase Transcytosis of Horseradish Peroxidase across Rat Hepatocytes Wed, 27 Jan 2010 09:16:30 +0000 http://www.hindawi.com/journals/bmri/2010/850320/ Horseradish peroxidase (HRP) is often used as a fluid-phase marker to characterize endocytic and transcytotic processes. Likewise, it has been applied to investigate the mechanisms of biliary secretion of fluid in rat liver hepatocytes. However, HRP contains mannose residues and thus binds to mannose receptors (MRs) on liver cells, including hepatocytes. To study the role of MR-mediated endocytosis of HRP transport in hepatocytes, we determined the influence of the oligosaccharid mannan on HRP biliary secretion in the isolated perfused rat liver. A 1-minute pulse of HRP was applied followed by marker-free perfusion. HRP appeared in bile with biphasic kinetics: a first peak at 7 minutes and a second peak at 15 minutes after labeling. Perfusion with 0.8 mg/mL HRP in the presence of a twofold excess of mannan reduced the first peak by 41% without effect on the second one. Together with recently published data on MR expression in rat hepatocytes this demonstrates two different mechanisms for HRP transcytosis: a rapid, receptor-mediated transport and a slower fluid-phase transport. Isabella Ellinger and Renate Fuchs Copyright © 2010 Isabella Ellinger and Renate Fuchs. All rights reserved. The Receptor for Advanced Glycation End Products (RAGE) and the Lung Tue, 19 Jan 2010 10:23:02 +0000 http://www.hindawi.com/journals/bmri/2010/917108/ The receptor for advanced glycation end products (RAGE) is a member of the immunoglobulin superfamily of cell surface molecules. As a pattern-recognition receptor capable of binding a diverse range of ligands, it is typically expressed at low levels under normal physiological conditions in the majority of tissues. In contrast, the lung exhibits high basal level expression of RAGE localised primarily in alveolar type I (ATI) cells, suggesting a potentially important role for the receptor in maintaining lung homeostasis. Indeed, disruption of RAGE levels has been implicated in the pathogenesis of a variety of pulmonary disorders including cancer and fibrosis. Furthermore, its soluble isoforms, sRAGE, which act as decoy receptors, have been shown to be a useful marker of ATI cell injury. Whilst RAGE undoubtedly plays an important role in the biology of the lung, it remains unclear as to the exact nature of this contribution under both physiological and pathological conditions. Stephen T. Buckley and Carsten Ehrhardt Copyright © 2010 Stephen T. Buckley and Carsten Ehrhardt. All rights reserved. Aquaporin-6 Expression in the Cochlear Sensory Epithelium Is Downregulated by Salicylates Tue, 12 Jan 2010 14:20:39 +0000 http://www.hindawi.com/journals/bmri/2010/264704/ We characterize the expression pattern of aquaporin-6 in the mouse inner ear by RT-PCR and immunohistochemistry. Our data show that in the inner ear aquaporin-6 is expressed, in both vestibular and acoustic sensory epithelia, by the supporting cells directly contacting hair cells. In particular, in the Organ of Corti, expression was strongest in Deiters' cells, which provide both a mechanical link between outer hair cells (OHCs) and the Organ of Corti, and an entry point for ion recycle pathways. Since aquaporin-6 is permeable to both water and anions, these results suggest its possible involvement in regulating OHC motility, directly through modulation of water and chloride flow or by changing mechanical compliance in Deiters' cells. In further support of this role, treating mice with salicylates, which impair OHC electromotility, dramatically reduced aquaporin-6 expression in the inner ear epithelia but not in control tissues, suggesting a role for this protein in modulating OHCs' responses. Paola Perin, Simona Tritto, Laura Botta, Jacopo Maria Fontana, Giulia Gastaldi, Sergio Masetto, Marisa Tosco, and Umberto Laforenza Copyright © 2010 Paola Perin et al. All rights reserved. The Vacuolar-Type H+-ATPase in Ovine Rumen Epithelium is Regulated by Metabolic Signals Mon, 04 Jan 2010 08:02:07 +0000 http://www.hindawi.com/journals/bmri/2010/525034/ In this study, the effect of metabolic inhibition (MI) by glucose substitution with 2-deoxyglucose (2-DOG) and/or application of antimycin A on ovine rumen epithelial cells (REC) vacuolar-type H+-ATPase (vH+-ATPase) activity was investigated. Using fluorescent spectroscopy, basal pHi of REC was measured to be 7.3±0.1 in HCO3−-free, glucose-containing NaCl medium. MI induced a strong pHi reduction (−0.44±0.04 pH units) with a more pronounced effect of 2-DOG compared to antimycin A (−0.30±0.03 versus −0.21±0.03 pH units). Treatment with foliomycin, a specific vH+-ATPase inhibitor, decreased REC pHi by 0.21±0.05 pH units. After MI induction, this effect was nearly abolished (−0.03±0.02 pH units). In addition, membrane-associated localization of vH+-ATPase B subunit disappeared. Metabolic control of vH+-ATPase involving regulation of its assembly state by elements of the glycolytic pathway could provide a means to adapt REC ATP consumption according to energy availability. Judith Kuzinski, Rudolf Zitnan, Christina Warnke-Gurgel, and Monika Schweigel Copyright © 2010 Judith Kuzinski et al. All rights reserved. Isolation of Osteosarcoma-Associated Human Antibodies from a Combinatorial Fab Phage Display Library Wed, 16 Dec 2009 15:18:54 +0000 http://www.hindawi.com/journals/bmri/2009/157531/ Osteosarcoma, a highly malignant disease, is the most common primary bone tumor and is frequently found in children and adolescents. In order to isolate antibodies against osteosarcoma antigens, a combinatorial osteosarcoma Fab library displayed on the surface of phages was used. After three rounds of selection on the surface of tumor cells, several osteosarcoma-reactive Fabs were detected. From these Fabs, five were better characterized, and despite having differences in their VH (heavy chain variable domain) and V𝜅 (kappa chain variable domain) regions, they all bound to a protein with the same molecular mass. Further analysis by cell ELISA and immunocytochemistry suggested that the Fabs recognize a membrane-associated tumor antigen expressed in higher amounts in neoplasic cells than in normal tissue. These results suggest that the human Fabs selected in this work are a valuable tool for the study of this neoplasia. Carmela Dantas-Barbosa, Fabrícia P. Faria, Marcelo M. Brigido, and Andrea Q. Maranhão Copyright © 2009 Carmela Dantas-Barbosa et al. All rights reserved. Phenotypic Transition of the Collecting Duct Epithelium in Congenital Urinary Tract Obstruction Sun, 13 Dec 2009 07:27:35 +0000 http://www.hindawi.com/journals/bmri/2010/696034/ Epithelial-mesenchymal transition (EMT) has emerged in recent years as an important process in the development of organ fibrosis in many human diseases. Our previous experience in a nonhuman primate model of obstructive nephropathy suggested that EMT of collecting duct epithelium contributes to the development of interstitial fibrosis. In this study we demonstrate for the first time in humans that obstructed fetal collecting duct epithelium undergoes transition to mesenchymal phenotype, characterized by decreased expression of epithelial markers, de novo expression of mesenchymal markers with subsequent loss of cell-cell interaction, disruption of the basement membrane, and increased deposition of extracellular matrix into the expanded interstitium of the obstructed kidney. The results of this study therefore support the previous findings from animal studies and suggest that EMT of the collecting duct epithelium might contribute to the development of interstitial fibrosis in human fetal obstructive nephropathy. Peter Trnka, Michael J. Hiatt, Larissa Ivanova, Alice F. Tarantal, and Douglas G. Matsell Copyright © 2010 Peter Trnka et al. All rights reserved. DNA, RNA, and Protein Extraction: The Past and The Present Mon, 30 Nov 2009 14:55:41 +0000 http://www.hindawi.com/journals/bmri/2009/574398/ Extraction of DNA, RNA, and protein is the basic method used in molecular biology. These biomolecules can be isolated from any biological material for subsequent downstream processes, analytical, or preparative purposes. In the past, the process of extraction and purification of nucleic acids used to be complicated, time-consuming, labor-intensive, and limited in terms of overall throughput. Currently, there are many specialized methods that can be used to extract pure biomolecules, such as solution-based and column-based protocols. Manual method has certainly come a long way over time with various commercial offerings which included complete kits containing most of the components needed to isolate nucleic acid, but most of them require repeated centrifugation steps, followed by removal of supernatants depending on the type of specimen and additional mechanical treatment. Automated systems designed for medium-to-large laboratories have grown in demand over recent years. It is an alternative to labor-intensive manual methods. The technology should allow a high throughput of samples; the yield, purity, reproducibility, and scalability of the biomolecules as well as the speed, accuracy, and reliability of the assay should be maximal, while minimizing the risk of cross-contamination. Siun Chee Tan and Beow Chin Yiap Copyright © 2009 Siun Chee Tan and Beow Chin Yiap. All rights reserved. Endocytosis and Recycling of Tight Junction Proteins in Inflammation Mon, 30 Nov 2009 10:22:08 +0000 http://www.hindawi.com/journals/bmri/2010/484987/ A critical function of the epithelial lining is to form a barrier that separates luminal contents from the underlying interstitium. This barrier function is primarily regulated by the apical junctional complex (AJC) consisting of tight junctions (TJs) and adherens junctions (AJs) and is compromised under inflammatory conditions. In intestinal epithelial cells, proinflammatory cytokines, for example, interferon-gamma (IFN-𝛾), induce internalization of TJ proteins by endocytosis. Endocytosed TJ proteins are passed into early and recycling endosomes, suggesting the involvement of recycling of internalized TJ proteins. This review summarizes mechanisms by which TJ proteins under inflammatory conditions are internalized in intestinal epithelial cells and point out comparable mechanism in nonintestinal epithelial cells. Markus Utech, Rudolf Mennigen, and Matthias Bruewer Copyright © 2010 Markus Utech et al. All rights reserved. Mechanisms of the Regulation of the Intestinal Exchanger NHE3 Wed, 25 Nov 2009 14:38:09 +0000 http://www.hindawi.com/journals/bmri/2010/238080/ A major of absorptive process in the proximal part of intestine and kidney is electroneutral exchange of and by exchanger type 3 (NHE3). During the past decade, significant advance has been achieved in the mechanisms of NHE3 regulation. A bulk of the current knowledge on exchanger regulation is based on heterologous expression of mammalian exchangers in exchanger deficient fibroblasts, renal epithelial, and intestinal epithelial cells. Based on the reductionist's approach, an understanding of NHE3 regulation has been greatly advanced. More recently, confirmations of in vitro studies have been made using animals deficient in one or more proteins but in some cases unexpected findings have emerged. The purpose of this paper is to provide a brief overview of recent progress in the regulation and functions of NHE3 present in the luminal membrane of the intestinal tract. Peijian He and C. Chris Yun Copyright © 2010 Peijian He and C. Chris Yun. All rights reserved. Molecular Mechanisms of Receptor-Mediated Endocytosis in the Renal Proximal Tubular Epithelium Sun, 22 Nov 2009 09:35:38 +0000 http://www.hindawi.com/journals/bmri/2010/403272/ Receptor-mediated endocytosis is a pivotal function of renal proximal tubule epithelial cells (PTECs) to reabsorb and metabolize substantial amounts of proteins and other substances in glomerular filtrates. The function accounts for the conservation of nutrients, including carrier-bound vitamins and trace elements, filtered by glomeruli. Impairment of the process results in a loss of such substances and development of proteinuria, an important clinical sign of kidney disease and a risk marker for cardiovascular disease. Megalin is a multiligand endocytic receptor expressed at clathrin-coated pits of PTEC, playing a central role in the process. Megalin cooperates with various membrane molecules and interacts with many intracellular adaptor proteins for endocytic trafficking. Megalin is also involved in signaling pathways in the cells. Megalin-mediated endocytic overload leads to damage of PTEC. Further studies are needed to elucidate the mechanism of megalin-mediated endocytosis and develop strategies for preventing the damage of PTEC. Akihiko Saito, Hiroyoshi Sato, Noriaki Iino, and Tetsuro Takeda Copyright © 2010 Akihiko Saito et al. All rights reserved. Tight Junctions: A Barrier to the Initiation and Progression of Breast Cancer? Sun, 15 Nov 2009 11:31:32 +0000 http://www.hindawi.com/journals/bmri/2010/460607/ Breast cancer is a complex and heterogeneous disease that arises from epithelial cells lining the breast ducts and lobules. Correct adhesion between adjacent epithelial cells is important in determining the normal structure and function of epithelial tissues, and there is accumulating evidence that dysregulated cell-cell adhesion is associated with many cancers. This review will focus on one cell-cell adhesion complex, the tight junction (TJ), and summarize recent evidence that TJs may participate in breast cancer development or progression. We will first outline the protein composition of TJs and discuss the functions of the TJ complex. Secondly we will examine how alterations in these functions might facilitate breast cancer initiation or progression; by focussing on the regulatory influence of TJs on cell polarity, cell fate and cell migration. Finally we will outline how pharmacological targeting of TJ proteins may be useful in limiting breast cancer progression. Overall we hope to illustrate that the relationship between TJ alterations and breast cancer is a complex one; but that this area offers promise in uncovering fundamental mechanisms linked to breast cancer progression. Kieran Brennan, Gozie Offiah, Elaine A. McSherry, and Ann M. Hopkins Copyright © 2010 Kieran Brennan et al. All rights reserved. Methyl-CpG-Binding PCR of Bloodspots for Confirmation of Fragile X Syndrome in Males Wed, 04 Nov 2009 13:40:11 +0000 http://www.hindawi.com/journals/bmri/2009/643692/ This study demonstrates that methyl-CpG-binding PCR (MB-PCR) is a rapid and simple method for detecting fragile X syndrome (FXS) in males, which is performed by verifying the methylation status of the FMR1 promoter in bloodspots. Proteins containing methyl-CpG-binding (MB) domains can be freeze-stored and used as stocks, and the entire test requires only a few hours. The minimum amount of DNA required for the test is 0.5 ng. At this amount, detection sensitivity is not hampered, even mixing with excess unmethylated alleles up to 320 folds. We examined bloodspots from 100 males, including 24 with FXS, in a blinded manner. The results revealed that the ability of MB-PCR to detect FMR1 promoter methylation was the same as that of Southern blot hybridization. Since individuals with 2 or more X chromosomes generally have methylated FMR1 alleles, MB-PCR cannot be used to detect FXS in females. Ching-Cherng Tzeng, Chiou-Ping Liou, Chien-Feng Li, Ming-Chi Lai, Li-Ping Tsai, Wei-Chen Cho, and Hui-Ting Chang Copyright © 2009 Ching-Cherng Tzeng et al. All rights reserved. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter Sun, 25 Oct 2009 10:16:02 +0000 http://www.hindawi.com/journals/bmri/2009/514287/ RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by and CMV enhancer- promoters. Compared to the vectors with or U6 promoter, the vector with a CMV enhancer- promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer- promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. Ma Weiwei, Xie Zhenhua, Liu Feng, Ning Hang, and Jiang Yuyang Copyright © 2009 Ma Weiwei et al. All rights reserved. The pol3-t Hyperrecombination Phenotype and DNA Damage-Induced Recombination in Saccharomyces cerevisiae Is RAD50 Dependent Mon, 12 Oct 2009 11:11:16 +0000 http://www.hindawi.com/journals/bmri/2009/312710/ The DNA polymerase 𝛿 (POL3/CDC2) allele pol3-t of Saccharomyces cerevisiae has previously been shown to be sensitive to methylmethanesulfonate (MMS) and has been proposed to be involved in base excision repair. Our results, however, show that the pol3-t mutation is synergistic for MMS sensitivity with MAG1, a known base excision repair gene, but it is epistatic with rad50 Δ, suggesting that POL3 may be involved not only in base excision repair but also in a RAD50 dependent function. We further studied the interaction of pol3-t with rad50 Δ by examining their effect on spontaneous, MMS-, UV-, and ionizing radiation-induced intrachromosomal recombination. We found that rad50 Δ completely abolishes the elevated spontaneous frequency of intrachromosomal recombination in the pol3-t mutant and significantly decreases UV- and MMS-induced recombination in both POL3 and pol3-t strains. Interestingly, rad50 Δ had no effect on 𝛾-ray-induced recombination in both backgrounds between 0 and 50 Gy. Finally, the deletion of RAD50 had no effect on the elevated frequency of homologous integration conferred by the pol3-t mutation. RAD50 is possibly involved in resolution of replication forks that are stalled by mutagen-induced external DNA damage, or internal DNA damage produced by growing the pol3-t mutant at the restrictive temperature. Alvaro Galli, Kurt Hafer, Tiziana Cervelli, and Robert H. Schiestl Copyright © 2009 Alvaro Galli et al. All rights reserved. Comparability of Microarray Data between Amplified and Non Amplified RNA in Colorectal Carcinoma Sun, 11 Oct 2009 14:18:43 +0000 http://www.hindawi.com/journals/bmri/2009/837170/ Microarray analysis reaches increasing popularity during the investigation of prognostic gene clusters in oncology. The standardisation of technical procedures will be essential to compare various datasets produced by different research groups. In several projects the amount of available tissue is limited. In such cases the preamplification of RNA might be necessary prior to microarray hybridisation. To evaluate the comparability of microarray results generated either by amplified or non amplified RNA we isolated RNA from colorectal cancer samples (stage UICC IV) following tumour tissue enrichment by macroscopic manual dissection (CMD). One part of the RNA was directly labelled and hybridised to GeneChips (HG-U133A, Affymetrix), the other part of the RNA was amplified according to the “Eberwine” protocol and was then hybridised to the microarrays. During unsupervised hierarchical clustering the samples were divided in groups regarding the RNA pre-treatment and 5.726 differentially expressed genes were identified. Using independent microarray data of 31 amplified vs. 24 non amplified RNA samples from colon carcinomas (stage UICC III) in a set of 50 predictive genes we validated the amplification bias. In conclusion microarray data resulting from different pre-processing regarding RNA pre-amplification can not be compared within one analysis. Roland S. Croner, Berthold Lausen, Vera Schellerer, Isabel Zeittraeger, Axel Wein, Claus Schildberg, Thomas Papadopoulos, Arno Dimmler, Eckhart G. Hahn, Werner Hohenberger, and Wolfgang M. Brueckl Copyright © 2009 Roland S. Croner et al. All rights reserved. Schwann Cells Overexpressing FGF-2 Alone or Combined with Manual Stimulation Do Not Promote Functional Recovery after Facial Nerve Injury Thu, 08 Oct 2009 12:24:18 +0000 http://www.hindawi.com/journals/bmri/2009/408794/ Purpose. To determine whether transplantation of Schwann cells (SCs) overexpressing different isoforms of fibroblast growth factor 2 (FGF-2) combined with manual stimulation (MS) of vibrissal muscles improves recovery after facial nerve transection in adult rat. Procedures. Transected facial nerves were entubulated with collagen alone or collagen plus naïve SCs or transfected SCs. Half of the rats received daily MS. Collateral branching was quantified from motoneuron counts after retrograde labeling from 3 facial nerve branches. Quality assessment of endplate reinnervation was combined with video-based vibrissal function analysis. Results. There was no difference in the extent of collateral axonal branching. The proportion of polyinnervated motor endplates for either naïve SCs or FGF-2 over-expressing SCs was identical. Postoperative MS also failed to improve recovery. Conclusions. Neither FGF-2 isoform changed the extent of collateral branching or polyinnervation of motor endplates; furthermore, this motoneuron response could not be overridden by MS. Kirsten Haastert, Maria Grosheva, Srebrina K. Angelova, Orlando Guntinas-Lichius, Emmanouil Skouras, Joern Michael, Claudia Grothe, Sarah A. Dunlop, and Doychin N. Angelov Copyright © 2009 Kirsten Haastert et al. All rights reserved. DNA Loci Cross-Talk through Thermodynamics Wed, 16 Sep 2009 09:19:26 +0000 http://www.hindawi.com/journals/bmri/2009/516723/ The recognition and pairing of specific DNA loci, though crucial for a plenty of important cellular processes, are produced by still mysterious physical mechanisms. We propose the first quantitative model from Statistical Mechanics, able to clarify the interaction allowing such “DNA cross-talk” events. Soluble molecules, which bind some DNA recognition sequences, produce an effective attraction between distant DNA loci; if their affinity, their concentration, and the relative DNA binding sites number exceed given thresholds, DNA colocalization occurs as a result of a thermodynamic phase transition. In this paper, after a concise report on some of the most recent experimental results, we introduce our model and carry out a detailed “in silico” analysis of it, by means of Monte Carlo simulations. Our studies, while rationalize several experimental observations, result in very interesting and testable predictions. Antonio Scialdone and Mario Nicodemi Copyright © 2009 Antonio Scialdone and Mario Nicodemi. All rights reserved. Construction of a Recombinant Eukaryotic Expression Plasmid Containing Human Calcitonin Gene and Its Expression in NIH3T3 Cells Wed, 19 Aug 2009 14:54:35 +0000 http://www.hindawi.com/journals/bmri/2009/241390/ Aim. To construct a recombinant eukaryotic expression plasmid containing human calcitonin (hCT) gene and express the gene in murine fibroblast NIH3T3 cells. Materials and Methods. A murine Ig-chain leader sequence and hCT gene were synthesized and cloned into pCDNA3.0 to form the pCDNA3.0-Ig-hCT eukaryotic expression vector, which was transfected into NIH3T3 cells. The mRNA and protein expressions and secretion of hCT were detected. Primarily cultured osteoclasts were incubated with the supernatant of pCDNA3.0-Igk-hCT-transfected NIH3T3 cells, and their numbers were counted and morphology observed. Results. The expression and secretion of hCT were successfully detected in pCDNA3.0-Igk-hCT-transfected NIH3T3 cells. The number of osteoclasts was decreased and the cells became crumpled when they were incubated with the supernatant of pCDNA3.0-Igk-hCT-transfected NIH3T3 cells. Conclusion. A recombinant eukaryotic expression vector containing hCT gene was successfully constructed and expressed in NIH3T3 cells. The secreted recombinant hCT inhibited the growth and morphology of osteoclasts. Xiaolin Li, Guozhong Jiang, Dan Wu, Xiuli Wang, and Bingfang Zeng Copyright © 2009 Xiaolin Li et al. All rights reserved. Oxaprozin-Induced Apoptosis on CD40 Ligand-Treated Human Primary Monocytes Is Associated with the Modulation of Defined Intracellular Pathways Mon, 10 Aug 2009 15:17:16 +0000 http://www.hindawi.com/journals/bmri/2009/478785/ The modulation of CD40L activity might represent a promising therapeutic target to reduce monocyte inflammatory functions in chronic diseases, such as rheumatoid arthritis. In the present study, we investigated the possible influence of nonsteroidal anti-inflammatory drugs (NSAIDs) on CD40L-induced monocyte survival. Monocytes were isolated from buffy coats by using Ficoll-Percoll gradients. Monocyte apoptosis was evaluated by fluorescence microscopy on cytopreps stained with acridine orange or using flow cytometry analysis of Annexin-V and Propidium Iodide staining. Akt and NF-B activation was assessed using western blot. Caspase 3 activity was determined spectrophotometrically. Among different NSAIDs, only oxaprozin dose-dependently increased apoptosis of CD40L-treated monocytes. Oxaprozin pro-apoptotic activity was associated with the inhibition of CD40L-triggered Akt and NF-B phosphorylation and the activation of caspase 3. In conclusion, our data suggest that oxaprozin-induced apoptosis in CD40L-treated human monocytes is associated with previously unknown cyclooxygenase (COX)-independent pathways. These intracellular proteins might be promising pharmacological targets to increase apoptosis in CD40L-treated monocytes. Fabrizio Montecucco, Maria Bertolotto, Luciano Ottonello, Alessandra Quercioli, François Mach, and Franco Dallegri Copyright © 2009 Fabrizio Montecucco et al. All rights reserved. Epsilon Haemoglobin Specific Antibodies with Applications in Noninvasive Prenatal Diagnosis Tue, 14 Jul 2009 14:16:17 +0000 http://www.hindawi.com/journals/bmri/2009/659219/ Invasive procedures for prenatal diagnosis are associated with increased risk of abortion; thus, development of noninvasive procedures would be beneficial. Based on the observation that embryonic nucleated red blood cell (NRBC) crosses the placenta and enters the circulation of pregnant women, the ability to identify such cell would allow development of such procedures. Identification of NRBCs in blood samples would be possible provided that specific antibodies are available. Here we have isolated recombinant antibodies using phage display. From the panel of antibody fragments specifically recognising 𝜀-Hb, one was chosen for further characterization, DAb1. DAb1 binds to 𝜀-Hb both in Western blots and immunocytochemistry. Several 𝜀-Hb positive cells were detected in a blood sample taken as postchorionic villus sampling (CVS). To evaluate the sensitivity of the method, K562 cells (which express 𝜀-Hb) were spiked in a blood sample followed by staining in solution and FACS analysis. Morten Dræby Sørensen, Regina Gonzalez Dosal, Kim Bak Jensen, Britta Christensen, Steen Kølvraa, Uffe Birk Jensen, and Peter Kristensen Copyright © 2009 Morten Dræby Sørensen et al. All rights reserved. High Specificity of Quantitative Methylation-Specific PCR Analysis for MGMT Promoter Hypermethylation Detection in Gliomas Mon, 01 Jun 2009 08:26:21 +0000 http://www.hindawi.com/journals/bmri/2009/531692/ Normal brain tissue from 28 individuals and 50 glioma samples were analyzed by real-time Quantitative Methylation-Specific PCR (QMSP). Data from this analysis were compared with results obtained on the same samples by MSP. QMSP analysis demonstrated a statistically significant difference in both methylation level (𝑃=.000009 Mann Whitney Test) and frequencies (𝑃=.0000007, Z-test) in tumour samples as compared with normal brain tissues. Although QMSP and MSP showed similar sensitivity, the specificity of QMSP analysis was significantly higher (93%; CI95%: 84%–100%) as compared with MSP (64%; 95%CI: 46%–82%). Our results suggest that QMSP analysis may represent a powerful tool to identify glioma patients that will benefit from alkylating agents chemotherapy. Paola Parrella, Antonella la Torre, Massimiliano Copetti, Vanna M. Valori, Raffaela Barbano, Angelo Notarangelo, Michele Bisceglia, Antonietta Pia Gallo, Teresa Balsamo, Maria Luana Poeta, Massimo Carella, Domenico Catapano, Salvatore Parisi, Bruno Dallapiccola, Evaristo Maiello, Vincenzo D'Angelo, and Vito Michele Fazio Copyright © 2009 Paola Parrella et al. All rights reserved. Duchenne and Becker Muscular Dystrophy: Contribution of a Molecular and Immunohistochemical Analysis in Diagnosis in Morocco Tue, 19 May 2009 08:56:08 +0000 http://www.hindawi.com/journals/bmri/2009/325210/ Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are X-linked recessive disorders caused by mutations of the DMD gene located at Xp21. In DMD patients, dystrophin is virtually absent; whereas BMD patients have 10% to 40% of the normal amount. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. To explain the contribution of immunohistochemical and genetic analysis in the diagnosis of these dystrophies, we present 10 cases of DMD/BMD with particular features. We have analyzed the patients with immunohistochemical staining and PCR multiplex to screen for exons deletions. Determination of the quantity and distribution of dystrophin by immunohistochemical staining can confirm the presence of dystrophinopathy and allows differentiation between DMD and BMD, but dystrophin staining is not always conclusive in BMD. Therefore, only identification involved mutation by genetic analysis can establish a correct diagnosis. Hanane Bellayou, Khalil Hamzi, Mohamed Abdou Rafai, Mehdi Karkouri, Ilham Slassi, Houssine Azeddoug, and Sellama Nadifi Copyright © 2009 Hanane Bellayou et al. All rights reserved. Molecularly Characterised Xenograft Tumour Mouse Models: Valuable Tools for Evaluation of New Therapeutic Strategies for Secondary Liver Cancers Sun, 15 Mar 2009 10:52:07 +0000 http://www.hindawi.com/journals/bmri/2009/437284/ To develop and evaluate new therapeutic strategies for the treatment of human cancers, well-characterised preclinical model systems are a prerequisite. To this aim, we have established xenotransplantation mouse models and corresponding cell cultures from surgically obtained secondary human liver tumours. Established xenograft tumours were patho- and immunohistologically characterised, and expression levels of cancer-relevant genes were quantified in paired original and xenograft tumours and the derivative cell cultures applying RT-PCR-based array technology. Most of the characteristic morphological and immunohistochemical features of the original tumours were shown to be maintained. No differences were found concerning expression of genes involved in cell cycle regulation and oncogenesis. Interestingly, cytokine and matrix metalloproteinase encoding genes appeared to be expressed differentially. Thus, the established models are closely reflecting pathohistological and molecular characteristics of the selected human tumours and may therefore provide useful tools for preclinical analyses of new antitumour strategies in vivo. Daniela Mischek, Ralf Steinborn, Helga Petznek, Christoph Bichler, Kurt Zatloukal, Michael Stürzl, Walter H. Günzburg, and Christine Hohenadl Copyright © 2009 Daniela Mischek et al. All rights reserved. Biomedical Applications of Colloidal Nanocrystals Wed, 04 Jun 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/082752/abs/ Marek Osinski, Thomas M. Jovin, and K. Yamamoto Copyright © 2007 Marek Osinski et al. All rights reserved. Imaging GABAc Receptors with Ligand-Conjugated Quantum Dots Thu, 17 Apr 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/076514/abs/ We report a methodology for labeling the GABAC receptor on the surface membrane of intact cells. This work builds upon our earlier work with serotonin-conjugated quantum dots and our studies with PEGylated quantum dots to reduce nonspecific binding. In the current approach, a PEGylated derivative of muscimol was synthesized and attached via an amide linkage to quantum dots coated in an amphiphilic polymer derivative of a modified polyacrylamide. These conjugates were used to image GABAC receptors heterologously expressed in Xenopus laevis oocytes. Ian D. Tomlinson, Hélène A. Gussin, Deborah M. Little, Michael R. Warnement, Haohua Qian, David R. Pepperberg, and Sandra J. Rosenthal Copyright © 2007 Ian D. Tomlinson et al. All rights reserved. Gel Electrophoresis of Gold-DNA Nanoconjugates Mon, 31 Mar 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/026796/abs/ Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effective diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined. T. Pellegrino, R. A. Sperling, A. P. Alivisatos, and W. J. Parak Copyright © 2007 T. Pellegrino et al. All rights reserved. Fluorescence Resonance Energy Transfer in Quantum Dot-Protein Kinase Assemblies Mon, 24 Mar 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/018081/abs/ In search of viable strategies to identify selective inhibitors of protein kinases, we have designed a binding assay to probe the interactions of human phosphoinositide-dependent protein kinase-1 (PDK1) with potential ligands. Our protocol is based on fluorescence resonance energy transfer (FRET) between semiconductor quantum dots (QDs) and organic dyes. Specifically, we have expressed and purified the catalytic kinase domain of PDK1 with an N-terminal histidine tag [His6-PDK1(ΔPH)]. We have conjugated this construct to CdSe-ZnS core-shell QDs coated with dihydrolipoic acid (DHLA) and tested the response of the resulting assembly to a molecular dyad incorporating an ATP ligand and a BODIPY chromophore. The supramolecular association of the BODIPY-ATP dyad with the His6-PDK1(ΔPH)-QD assembly encourages the transfer of energy from the QDs to the BODIPY dyes upon excitation. The addition of ATP results in the displacement of BODIPY-ATP from the binding domain of the His6-PDK1(ΔPH) conjugated to the nanoparticles. The competitive binding, however, does not prevent the energy transfer process. A control experiment with QDs, lacking the His6-PDK1(ΔPH), indicates that the BODIPY-ATP dyad adsorbs nonspecifically on the surface of the nanoparticles, promoting the transfer of energy from the CdSe core to the adsorbed BODIPY dyes. Thus, the implementation of FRET-based assays to probe the binding domain of PDK1 with luminescent QDs requires the identification of energy acceptors unable to interact nonspecifically with the surface of the nanoparticles. Ibrahim Yildiz, Xinxin Gao, Thomas K. Harris, and Françisco M. Raymo Copyright © 2007 Ibrahim Yildiz et al. All rights reserved. Fluorescence Intensity and Intermittency as Tools for Following Dopamine Bioconjugate Processing in Living Cells Mon, 24 Mar 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/070145/abs/ CdSe/ZnS quantum dots (QDs) conjugated to biomolecules that quench their fluorescence, particularly dopamine, have particular spectral properties that allow determination of the number of conjugates per particle, namely, photoenhancement and photobleaching. In this work, we quantify these properties on a single-particle and ensemble basis in order to evaluate their usefulness as a tool for indicating QD uptake, breakdown, and processing in living cells. This creates a general framework for the use of fluorescence quenching and intermittency to better understand nanoparticle-cell interactions. Rafael Khatchadourian, Alexia Bachir, Samuel J. Clarke, Colin D. Heyes, Paul W. Wiseman, and Jay L. Nadeau Copyright © 2007 Rafael Khatchadourian et al. All rights reserved. Design of Biotin-Functionalized Luminescent Quantum Dots Tue, 18 Mar 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/090651/abs/ We report the design and synthesis of a tetraethylene glycol- (TEG-) based bidentate ligand functionalized with dihydrolipoic acid (DHLA) and biotin (DHLA—TEG—biotin) to promote biocompatibility of luminescent quantum dots (QD's). This new ligand readily binds to CdSe—ZnS core-shell QDs via surface ligand exchange. QDs capped with a mixture of DHLA and DHLA—TEG—biotin or polyethylene glycol- (PEG-) (molecular weight average ∼600) modified DHLA (DHLA—PEG600) and DHLA—TEG—biotin are easily dispersed in aqueous buffer solutions. In particular, homogeneous buffer solutions of QDs capped with a mixture of DHLA—PEG600 and DHLA—TEG—biotin that are stable over broad pH range have been prepared. QDs coated with mixtures of DHLA/DHLA—TEG—biotin and with DHLA—PEG600/DHLA—TEG—biotin were tested in surface binding assays and the results indicate that biotin groups on the QD surface interact specifically with NeutrAvidin-functionalized microtiter well plates. Kimihiro Susumu, H. Tetsuo Uyeda, Igor L. Medintz, and Hedi Mattoussi Copyright © 2007 Kimihiro Susumu et al. All rights reserved. Blue-Emitting Small Silica Particles Incorporating ZnSe-Based Nanocrystals Prepared by Reverse Micelle Method Wed, 27 Feb 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/052971/abs/ ZnSe-based nanocrystals (ca. 4-5 nm in diameter) emitting in blue region (ca. 445 nm) were incorporated in spherical small silica particles (20–40 nm in diameter) by a reverse micelle method. During the preparation, alkaline solution was used to deposit the hydrolyzed alkoxide on the surface of nanocrystals. It was crucially important for this solution to include Zn2+ ions and surfactant molecules (thioglycolic acid) to preserve the spectral properties of the final silica particles. This is because these substances in the solution prevent the surface of nanocrystals from deterioration by dissolution during processing. The resultant silica particles have an emission efficiency of 16% with maintaining the photoluminescent spectral width and peak wavelength of the initial colloidal solution. Masanori Ando, Chunliang Li, Ping Yang, and Norio Murase Copyright © 2007 Masanori Ando et al. All rights reserved. Clinical Potential of Quantum Dots Wed, 20 Feb 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/076087/abs/ Advances in nanotechnology have led to the development of novel fluorescent probes called quantum dots. Quantum dots have revolutionalized the processes of tagging molecules within research settings and are improving sentinel lymph node mapping and identification in vivo studies. As the unique physical and chemical properties of these fluorescent probes are being unraveled, new potential methods of early cancer detection, rapid spread and therapeutic management, that is, photodynamic therapy are being explored. Encouraging results of optical and real time identification of sentinel lymph nodes and lymph flow using quantum dots in vivo models are emerging. Quantum dots have also superseded many of the limitations of organic fluorophores and are a promising alternative as a research tool. In this review, we examine the promising clinical potential of quantum dots, their hindrances for clinical use and the current progress in abrogating their inherent toxicity. Arthur M. Iga, John H. P. Robertson, Marc C. Winslet, and Alexander M. Seifalian Copyright © 2007 Arthur M. Iga et al. All rights reserved. Superparamagnetic Iron Oxide Nanoparticles Coated with Galactose-Carrying Polymer for Hepatocyte Targeting Tue, 19 Feb 2008 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/094740/abs/ Our goal is to develop the functionalized superparamagnetic iron oxide nanoparticles (SPIONs) demonstrating the capacities to be delivered in liver specifically and to be dispersed in physiological environment stably. For this purpose, SPIONs were coated with polyvinylbenzyl-O-β-D-galactopyranosyl-D-gluconamide (PVLA) having galactose moieties to be recognized by asialoglycoprotein receptors (ASGP-R) on hepatocytes. For use as a control, we also prepared SPIONs coordinated with 2-pyrrolidone. The sizes, size distribution, structure, and coating of the nanoparticles were characterized by transmission electron microscopy (TEM), electrophoretic light scattering spectrophotometer (ELS), X-ray diffractometer (XRD), and Fourier transform infrared (FT-IR), respectively. Intracellular uptake of the PVLA-coated SPIONs was visualized by confocal laser scanning microscopy, and their hepatocyte-specific delivery was also investigated through magnetic resonance (MR) images of rat liver. MRI experimental results indicated that the PVLA-coated SPIONs possess the more specific accumulation property in liver compared with control, which suggests their potential utility as liver-targeting MRI contrast agent. Mi Kyong Yoo, In Yong Kim, Eun Mi Kim, Hwan-Jeong Jeong, Chang-Moon Lee, Yong Yeon Jeong, Toshihiro Akaike, and Chong Su Cho Copyright © 2007 Mi Kyong Yoo et al. All rights reserved. Development of FRET-Based Assays in the Far-Red Using CdTe Quantum Dots Wed, 12 Dec 2007 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/054169/abs/ Colloidal quantum dots (QDs) are now commercially available in a biofunctionalized form, and Förster resonance energy transfer (FRET) between bioconjugated dots and fluorophores within the visible range has been observed. We are particularly interested in the far-red region, as from a biological perspective there are benefits in pushing to ∼700 nm to minimize optical absorption (ABS) within tissue and to avoid cell autofluorescence. We report on FRET between streptavidin- (STV-) conjugated CdTe quantum dots, Qdot705-STV, with biotinylated DY731-Bio fluorophores in a donor-acceptor assay. We also highlight the changes in DY731-Bio absorptivity during the streptavidin-biotin binding process which can be attributed to the structural reorientation. For fluorescence beyond 700 nm, different alloy compositions are required for the QD core and these changes directly affect the fluorescence decay dynamics producing a marked biexponential decay with a long-lifetime component in excess of 100 nanoseconds. We compare the influence of the two QD relaxation routes upon FRET dynamics in the presence of DY731-Bio. E. Z. Chong, D. R Matthews, H. D. Summers, K. L. Njoh, R. J. Errington, and P. J. Smith Copyright © 2007 E. Z. Chong et al. All rights reserved. Fluorescent Nanoparticle-Based Indirect Immunofluorescence Microscopy for Detection of Mycobacterium tuberculosis Sun, 25 Nov 2007 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/089364/abs/ A method of fluorescent nanoparticle-based indirect immunofluorescence microscopy (FNP-IIFM) was developed for the rapid detection of Mycobacterium tuberculosis. An anti-Mycobacterium tuberculosis antibody was used as primary antibody to recognize Mycobacterium tuberculosis, and then an antibody binding protein (Protein A) labeled with Tris(2,2-bipyridyl)dichlororuthenium(II) hexahydrate (RuBpy)-doped silica nanoparticles was used to generate fluorescent signal for microscopic examination. Prior to the detection, Protein A was immobilized on RuBpy-doped silica nanoparticles with a coverage of ∼5.1×102 molecules/nanoparticle. With this method, Mycobacterium tuberculosis in bacterial mixture as well as in spiked sputum was detected. The use of the fluorescent nanoparticles reveals amplified signal intensity and higher photostability than the direct use of conventional fluorescent dye as label. Our preliminary studies have demonstrated the potential application of the FNP-IIFM method for rapid detection of Mycobacterium tuberculosis in clinical samples. Dilan Qin, Xiaoxiao He, Kemin Wang, Xiaojun Julia Zhao, Weihong Tan, and Jiyun Chen Copyright © 2007 Dilan Qin et al. All rights reserved. Getting Across the Plasma Membrane and Beyond: Intracellular Uses of Colloidal Semiconductor Nanocrystals Thu, 15 Nov 2007 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/068963/abs/ Semiconductor nanocrystals (NCs) are increasingly being used as photoluminescen markers in biological imaging. Their brightness, large Stokes shift, and high photostability compared to organic fluorophores permit the exploration of biological phenomena at the single-molecule scale with superior temporal resolution and spatial precision. NCs have predominantly been used as extracellular markers for tagging and tracking membrane proteins. Successful internalization and intracellular labelling with NCs have been demonstrated for both fixed immunolabelled and live cells. However, the precise localization and subcellular compartment labelled are less clear. Generally, live cell studies are limited by the requirement of fairly invasive protocols for loading NCs and the relatively large size of NCs compared to the cellular machinery, along with the subsequent sequestration of NCs in endosomal/lysosomal compartments. For long-period observation the potential cytotoxicity of cytoplasmically loaded NCs must be evaluated. This review focuses on the challenges of intracellular uses of NCs. Camilla Luccardini, Aleksey Yakovlev, Stéphane Gaillard, Marcel van ‘t Hoff, Alicia Piera Alberola, Jean-Maurice Mallet, Wolfgang J. Parak, Anne Feltz, and Martin Oheim Copyright © 2007 Camilla Luccardini et al. All rights reserved. Time-Resolved Analysis of a Highly Sensitive Förster Resonance Energy Transfer Immunoassay Using Terbium Complexes as Donors and Quantum Dots as Acceptors Mon, 10 Sep 2007 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/079169/abs/ CdSe/ZnS core/shell quantum dots (QDs) are used as efficient Förster Resonance Energy Transfer (FRET) acceptors in a time-resolved immunoassays with Tb complexes as donors providing a long-lived luminescence decay. A detailed decay time analysis of the FRET process is presented. QD FRET sensitization is evidenced by a more than 1000-fold increase of the QD luminescence decay time reaching ca. 0.5 milliseconds, the same value to which the Tb donor decay time is quenched due to FRET to the QD acceptors. The FRET system has an extremely large Förster radius of approx. 100 Å and more than 70% FRET efficiency with a mean donor-acceptor distance of ca. 84 Å, confirming the applied biotin-streptavidin binding system. Time-resolved measurement allows for suppression of short-lived emission due to background fluorescence and directly excited QDs. By this means a detection limit of 18 attomol QDs within the immunoassay is accomplished, an improvement of more than two orders of magnitude compared to commercial systems. Niko Hildebrandt, Loïc J. Charbonnière, and Hans-Gerd Löhmannsröben Copyright © 2007 Niko Hildebrandt et al. All rights reserved. Preparation and Characterization of Poly(D,L-Lactide-co-Glycolide) Nanoparticles Containing Ascorbic Acid Mon, 03 Sep 2007 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2007/084965/abs/ This paper is covering new, simplistic method of obtaining the system for controlled delivery of the ascorbic acid. Copolymer poly (D,L-lactide-co-glycolide) (DLPLG) nanoparticles are produced using physical method with solvent/nonsolvent systems where obtained solutions were centrifuged. The encapsulation of the ascorbic acid in the polymer matrix is performed by homogenization of water and organic phases. Particles of the DLPLG with the different content of ascorbic acid have different morphological characteristics, that is, variable degree of uniformity, agglomeration, sizes, and spherical shaping. Mean sizes of nanoparticles, which contain DLPLG/ascorbic acid in the ratio 85/150%, were between 130 to 200 nm depending on which stereological parameters are considered (maximal diameters Dmax, feret X, or feret Y). By introducing up to 15% of ascorbic acid, the spherical shape, size, and uniformity of DLPLG particles are preserved. The samples were characterized by infrared spectroscopy, scanning electron microscopy, stereological analysis, and ultraviolet spectroscopy. Magdalena M. Stevanović, Branka Jordović, and Dragan P. Uskoković Copyright © 2007 Magdalena M. Stevanović et al. All rights reserved. Nucleofection: A New Method for Cutaneous Gene Transfer? Mon, 20 Nov 2006 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2006/026060/abs/ Background. Transfection efficacy after nonviral gene transfer in primary epithelial cells is limited. The aim of this study was to compare transfection efficacy of the recently available method of nucleofection with the established transfection reagent FuGENE6. Methods. Primary human keratinocytes (HKC), primary human fibroblasts (HFB), and a human keratinocyte cell line (HaCaT) were transfected with reporter gene construct by FuGENE6 or Amaxa Nucleofector device. At corresponding time points, β-galactosidase expression, cell proliferation (MTT-Test), transduction efficiency (X-gal staining), cell morphology, and cytotoxicity (CASY) were determined. Results. Transgene expression after nucleofection was significantly higher in HKC and HFB and detected earlier (3 h vs. 24 h) than in FuGENE6. After lipofection 80%–90% of the cells remained proliferative without any influence on cell morphology. In contrast, nucleofection led to a decrease in keratinocyte cell size, with only 20%–42% proliferative cells. Conclusion. Related to the method-dependent increase of cytotoxicity, transgene expression after nucleofection was earlier and higher than after lipofection. Frank Jacobsen, Janine Mertens-Rill, Juergen Beller, Tobias Hirsch, Adrien Daigeler, Stefan Langer, Marcus Lehnhardt, Hans-Ulrich Steinau, and Lars Steinstraesser Copyright © 2006 Frank Jacobsen et al. All rights reserved. Rapid Site-Directed Mutagenesis Using Two-PCR-Generated DNA Fragments Reproducing the Plasmid Template Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2003/316759/abs/ We describe a new rapid and efficient polymerase chain reaction (PCR)-based site-directed mutagenesis method. This procedure is effective with any plasmid and it employs four oligonucleotide primers. One primer contains the desired mutation, the second is oriented in the opposite direction (one of these two primers should be phosphorylated), and the third and fourth should be coding in complementary fashion for a unique restriction site to be introduced in a nonessential region. The method consists of two simultaneous PCR reactions; the PCR products are digested with the enzyme that recognizes the newly introduced unique restriction site and then ligased and used to transform competent bacteria. Additionally, the use of Dpn I facilitates the elimination of template DNA. The newly introduced restriction site is essential for ligation in the correct orientation of the two-PCR products and is further used for mutant screening. Resulting plasmids carry both the new restriction site and the desired mutation. Using this method, more than 20 mutants have already been generated (using two different kinds of templates); all these mutants were sequenced for the desired mutation and transfected into AtT-20 cells and the expressed mutant proteins encoded by the vector were assayed. Flore Allemandou, Jürg Nussberger, Hans R. Brunner, and Noureddine Brakch Copyright © 2003 Hindawi Publishing Corporation. All rights reserved. DNA Microarrays in Medicine: Can the Promises Be Kept? Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2002/279792/abs/ Tarik Möröy Copyright © 2002 Hindawi Publishing Corporation. All rights reserved. Retrotransposition-Competent Human LINE-1 Induces Apoptosis in Cancer Cells With Intact p53 Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2004/461360/abs/ Retrotransposition of human LINE-1 (L1) element, a major representative non-LTR retrotransposon in the human genome, is known to be a source of insertional mutagenesis. However, nothing is known about effects of L1 retrotransposition on cell growth and differentiation. To investigate the potential for such biological effects and the impact that human L1 retrotransposition has upon cancer cell growth, we examined a panel of human L1 transformed cell lines following a complete retrotransposition process. The results demonstrated that transposition of L1 leads to the activation of the p53-mediated apoptotic pathway in human cancer cells that possess a wild-type p53. In addition, we found that inactivation of p53 in cells, where L1 was undergoing retrotransposition, inhibited the induction of apoptosis. This suggests an association between active retrotransposition and a competent p53 response in which induction of apoptosis is a major outcome. These data are consistent with a model in which human retrotransposition is sensed by the cell as a “genetic damaging event” and that massive retrotransposition triggers signaling pathways resulting in apoptosis. Abdelali Haoudi, O. John Semmes, James M. Mason, and Ronald E. Cannon Copyright © 2004 Hindawi Publishing Corporation. All rights reserved. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2002/419693/abs/ Duchenne and Becker muscular dystrophy (DMD and BMD) are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn). Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR) to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country. Aziza Sbiti, Fatiha El Kerch, and Abdelaziz Sefiani Copyright © 2002 Hindawi Publishing Corporation. All rights reserved. Playing Tag with HIF: The VHL Story Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2002/496723/abs/ Inactivation of the von Hippel-Lindau (VHL) tumour suppressor gene product pVHL is the cause of inherited VHL disease and is associated with sporadic kidney cancer. pVHL is found in a multiprotein complex with elongins B/C, Cul2, and Rbx1 forming an E3 ubiquitin ligase complex called VEC. This modular enzyme targets the α subunits of hypoxia-inducible factor (HIF) for ubiquitin-mediated destruction. Consequently, tumour cells lacking functional pVHL overproduce the products of HIF-target genes such as vascular endothelial growth factor (VEGF), which promotes angiogenesis. This likely accounts for the hypervascular nature of VHL-associated neoplasms. Although pVHL has been linked to the cell-cycle, differentiation, and the regulation of extracellular matrix assembly, microenvironment pH, and tissue invasiveness, this review will focus on the recent insights into the molecular mechanisms governing the E3 ubiquitin ligase function of VEC. Sherri K. Leung and Michael Ohh Copyright © 2002 Hindawi Publishing Corporation. All rights reserved. Role of Peroxisome Proliferator-Activated Receptors in Inflammation Control Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2004/927276/abs/ Peroxisome proliferator-activated receptors (PPARs) were discovered over a decade ago, and were classified as orphan members of the nuclear receptor superfamily. To date, three PPAR subtypes have been discovered and characterized (PPARα, β/δ, γ). Different PPAR subtypes have been shown to play crucial roles in important diseases and conditions such as obesity, diabetes, atherosclerosis, cancer, and fertility. Among the most studied roles of PPARs is their involvement in inflammatory processes. Numerous studies have revealed that agonists of PPARα and PPARγ exert anti-inflammatory effects both in vitro and in vivo. Using the carrageenan-induced paw edema model of inflammation, a recent study in our laboratories showed that these agonists hinder the initiation phase, but not the late phase of the inflammatory process. Furthermore, in the same experimental model, we recently also observed that activation of PPARδ exerted an anti-inflammatory effect. Despite the fact that exclusive dependence of these effects on PPARs has been questioned, the bulk of evidence suggests that all three PPAR subtypes, PPARα,δ,γ, play a significant role in controlling inflammatory responses. Whether these subtypes act via a common mechanism or are independent of each other remains to be elucidated. However, due to the intensity of research efforts in this area, it is anticipated that these efforts will result in the development of PPAR ligands as therapeutic agents for the treatment of inflammatory diseases. Jihan Youssef and Mostafa Badr Copyright © 2004 Hindawi Publishing Corporation. All rights reserved. Randomly Amplified DNA Fingerprinting: A Culmination of DNA Marker Technologies Based on Arbitrarily-Primed PCR Amplification Mon, 01 Jan 1900 00:00:00 +0000 http://www.hindawi.com/journals/bmri/2002/965079/abs/ Arbitrarily-primed DNA markers can be very useful for genetic fingerprinting and for facilitating positional cloning of genes. This class of technologies is particularly important for less studied species, for which genome sequence information is generally not known. The technologies include Randomly Amplified Polymorphic DNA (RAPD), DNA Amplification Fingerprinting (DAF), and Amplified Fragment Length Polymorphism (AFLP). We have modified the DAF protocol to produce a robust PCR-based DNA marker technology called Randomly Amplified DNA Fingerprinting (RAF). While the protocol most closely resembles DAF, it is much more robust and sensitive because amplicons are labelled with either radioactive 33P or fluorescence in a 30-cycle PCR, and then separated and detected on large polyacrylamide sequencing gels. Highly reproducible RAF markers were readily amplified from either purified DNA or alkali-treated intact leaf tissue. RAF markers typically display dominant inheritance. However, a small but significant portion of the RAF markers exhibit codominant inheritance and represent microsatellite loci. RAF compares favorably with AFLP for efficiency and reliability on many plant genomes, including the very large and complex genomes of sugarcane and wheat. While the two technologies detect about the same number of markers per large polyacrylamide gel, advantages of RAF over AFLP include: (i) no requirement for enzymatic template preparation, (ii) one instead of two PCRs, and (iii) overall cost. RAF and AFLP were shown to differ in the selective basis of amplification of markers from genomes and could therefore be used in complementary fashion for some genetic studies. Julie Waldron, Cameron P. Peace, Iain R. Searle, Agnelo Furtado, Nick Wade, Ian Findlay, Michael W. Graham, and Bernard J. Carroll Copyright © 2002 Hindawi Publishing Corporation. All rights reserved.