823597.fig.002
Figure 2: Degradation of untagged and N-terminus and C-terminus tagged versions of human DJ-1 L166P. The untagged human DJ-1 L166P (hDJ-1 L166P) construct has been described previously [49]. The C-terminal His-V5 tagged hDJ-1 L166P was obtained by PCR amplification with the following oligonucleotides (forward BamH1-DJ-1; 5′GGAAGGATCCATGGCTTCCAAAAGAGCTCTGG 3′ and reverse Nonstop-hDJ-1; 5′GTCTTTAAGAACAAGTGGCGCCTTCACTTGAGC 3′) and cloned into pcDNA 3.1/V5-His Topo vector from Invitrogen The N-terminal 3xFlag- tagged hDJ-1 L166P was obtained by PCR amplification with the following oligonucleotides (forward BamH1-hDJ-1 and reverse XhoI-hDJ-1 5′GCGCCTCGAGCTAGTCTTTAAGAACAAGTGGAGCC 3′) and cloned into the pCMV-3Tag 1-A vector. N2a cells were cultured in DMEM medium with 10% FBS and transiently transfected with the different hDJ-1 L166P constructs. Transfected cells were treated with cycloheximide (20  g/mL) for the times indicated and analyzed by Western immunoblotting with anti-hDJ-1specific antibodies, as described in [49]. Results presented are expressed as mean s.e.m for at least three independent experiments.