Table 2: Primers used for amplifying metalloproteinase sequences from Crotalus s. scutulatus. Genomic DNA and sequence comparison to other snake venom metalloproteinases (MP). Nonconserved nucleotides are indicated in bold.

PrimerAnnealing siteCorresponding sequence

MP (sense)GCCCCCAAAATGTGTGGGGTAAC
Atrolysin (558–580)GCCCCCAAAATGTGTGGGGTAAC
Artolysin (567–589)GCCCCCAAAATGTGTGGGGTAAC
Atrolysin (488–510)GCCCCCAAAATGTGTGGGGTAAC
Atrolysin (548–570)GCCCCCAAAATGTGTGGGGTAAC
Catrocollastatin (537–559)GCCCTCAAAATGTGTGGGGTAAC

MP (antisense)TTCTTCTCCCGCCTCCAAAAGTTC
Atrolysin (1329–1306)TTCTTCTCCCACCTCCAAAAGTTC
Atrolysin (1328–1305)TTCTTCTCCCGCCTCCAAAAGTTC
Atrolysin (1327–1304)TTCTTCTCCCGCCTCCAAAAGTTC
Atrolysin (1248–1225)TTCTTCTCCCGCCTCCAAAAGTTC
Atrolysin (1308–1285)TTCTATTCCCGCCTCCAAAAGTTC
Catrocollastatin (1297–1274)TTCTTCTCCGGCTTCCAAAAGTTC