Colonization of a Central Venous Catheter by the Hyaline Fungus <i>Fusarium solani</i> Species Complex: A Case Report and SEM Imaging

<table>Percent nucleotide identity in the ITS1 rRNA region of isolates<i> of Fusarium </i>species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.</table>

Case Reports in Medicine

fig1

Figure 1

Figure 1: Colonization of a Central Venous Catheter by the Hyaline Fungus <i>Fusarium solani</i> Species Complex: A Case Report and SEM Imaging 

Case Reports in Medicine

Colonization of a Central Venous Catheter by the Hyaline Fungus Fusarium solani Species Complex: A Case Report and SEM Imaging

Figure 1