618358.fig.001
Figure 1: Percent nucleotide identity in the ITS1 rRNA region of isolates of Fusarium species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.