Table 1: Primer sequences used in this study.

GeneForward (5′–3′)Reverse (5′–3′)

Col-IαAGAGCATGACCGATGGATTCCCTTCTTGAGGTTGCCAGTC
TGFβ1AAGCAGTGCCAGAACCCCCACGTGTTGCTCCACAGTTGACTTGA
TGFβ2TGTGGGTACCTTGATGCCATCCCGGTCGAAGGAGAGCCATTCCCCCT
TGFβ3CTCCCGATGGCGAAAGGCCGCCTTCACCTGACCACTCTGCCCT