Table 1: Primers used in real-time RT-PCR analysis.

GenePrimer sequence SpeciesAmplicon size (bp)

MMP1Forward: 5′ GAAGCCAGATGCTGAAAC 3′Rabbit237
Reverse: 5′ TGACCCTTGGAGACTTTG 3′
MMP2Forward: 5′ CTGAAGAGCGTGAAGGTTGG 3′Rabbit221
Reverse: 5′ TGAGGGTTGACGGGATTG 3′
TIMP-1Forward: 5′ TCCCACAAATCCCAGAAC 3′Rabbit229
Reverse: 5′ CTGTCCACAAGCAATGAG 3′
TGF- Forward: 5′ CACCCAGTGACACAGATGAG 3′Rabbit248
Reverse: 5′ ATGTTGAGCCCGTTCCAG 3′
P311Forward: 5′ CGTCCCAAAGGAAGTGAAC 3′Rabbit115
Reverse: 5′ TCAGAAAGAGTGGCGGTAG 3′
Caspase-3Forward: 5′ TAAGCCACGGTGATGAAG 3′Rabbit136
Reverse: 5′ CGGCAAGCCTGAATAATG 3′
Caspase-9Forward: 5′ GAACTTCAGCAGCACCTC 3′Rabbit130
Reverse: 5′ CATTTCCTTGGCGGTCAG 3′
GAPDHForward: 5′ CTCCTGCGACTTCAACAGTG 3′Rabbit172
Reverse: 5′ TGAGGGCTCTTACTCCTTGG 3′