Table 1: Description of the primer sequences.

GeneForward and reverse primer sequencesAnnealing temperature (°C)Length of amplified product (bp)

β-actin F: 5′CCTGTACGCCAACACAGTGC3′59211
R: 5′ATACTCCTGCTTGCTGATCC3′
CDKN1CF: 5′CTGCGGTGAGCCAATTTAGAG3′59231
R: 5′CCTTGGGACCAGTGTACCTTCT3′
PTCH2F:5′GGCTTCGTGCTTACTTCCA3′59259
R: 5′TGGCGTGCGGTCTGTAT3′