Table 1: Oligocucleotide primers that were used in this study.

Gene*Primer sequences (5′-3′)

16S rRNA ForwardCCTACGGGAGGCAGCAGTAG
ReverseCAACAGAGCTTTACGATCCGAAA
gtfB ForwardAGCAATGCAGCCAATCTACAAAT
ReverseACGAACTTTGCCGTTATTGTCA
gtfC ForwardGGTTTAACGTCAAAATTAGCTGTATTAGC
ReverseCTCAACCAACCGCCACTGTT
gtfD ForwardACAGCAGACAGCAGCCAAGA
ReverseACTGGGTTTGCTGCGTTTG
brpA ForwardGGAGGAGCTGCATCAGGATTC
ReverseAACTCCAGCACATCCAGCAAG
gbpB ForwardATGGCGGTTATGGACACGTT
ReverseTTTGGCCACCTTGAACACCT
relA ForwardACAAAAAGGGTATCGTCCGTACAT
ReverseAATCACGCTTGGTATTGCTAATTG
spaP ForwardGACTTTGGTAATGGTTATGCATCAA
ReverseTTTGTATCAGCCGGATCAAGTG
vicR ForwardTGACACGATTACAGCCTTTGATG
ReverseCGTCTAGTTCTGGTAACATTAAGTCCAATA

Based on the NCBI S. mutans genome database.