Table 1: Sequences of primers used for real-time PCR.

GenePrimer sequence (5′-3′)

Collagen ISense: TCCTGGCAATCGTGGTTCAA
Anti-sense: ACCAGCTGGGCCAACATTTC
Collagen IIISense: GGTCCTGCAGGTAACAGTGGTTC
Anti-sense: TGCTCCAGTTAGCCCTGCAA
TGF-β1Sense: TGCGCCTGCAGAGATTCAAG
Anti-sense: AGGTAACGCCAGGAATTGTTGCTA
α-SMASense: AGCCAGTCGCCATCAGGAAC
Anti-sense: CCGGAGCCATTGTCACACAC
β-actinSense: GGAGATTACTGCCCTGGCTCCTA
Anti-sense: GACTCATCGTACTCCTGCTTGCTG