The Effectiveness and Mechanism of Toona sinensis Extract Inhibit Attachment of Pandemic Influenza A (H1N1) Virus

Table 1

Necleotide sequences of the primers and TaqMan probes.

Gene name	Sequence (5′-3′)	Accession no./nucleotide position	Amplicon size
VCAM-1	Forward: catgacctgttccagcgagg	NM_080682.2: 950–969	247 bp
	Reverse: cattcacgaggccaccactc	NM_080682.2: 1178–1197
ICAM-1	Forward: ccttcctcaccgtgtactgg	J03132.1: 371–390	90 bp
	Reverse: agcgtagggtaaggttcttgc	J03132.1: 440–460
E-selectin	Forward: ggttgagtgtgatgctgtga	NM_000450.2: 874–893	264 bp
	Reverse: gaaggtgaactctccagcag	NM_000450.2: 1119–1138
Fractalkine (CX3CL1)	Forward: atcaacagaaccaggcatca	NM_002996.3: 219–238	151 bp
	Reverse: gccgccatttcgagttag	NM_002996.3: 353–370
IL-8	Forward: agacagcagagcacacaagc	NM_000584.2: 4–43	62 bp
	Reverse: atggttccttccggtggt	NM_000584.2: 68–85
TLR3	Forward: agttgtcatcgaatcaaattaaag	NM_003265.2: 707–732	62 bp
	Reverse: aatcttccaattgcgtgaaaa	NM_003265.2: 749–769
Bcl-2-related protein A1	Forward: caggagaatggataaggcaaa	NM_001114735: 571–591	63 bp
	Reverse: accagcataggtgtgtgattgt	NM_001114735: 613–634

5′-End labeled with fluorescein (FAM) and the 3′-end labeled with a dark quencher dye.