Table 1: Sequences of primers used in the realtime PCR.

Primer namePrimer sequence

GRP78-forward5′ CCAAGACAGCACAGACAGATTG 3′
GRP78-reverse5′ CCACGAACCAGGCGAAGG 3′
GADD153-forward5′ GCTTGGCTGACTGAGGAGGAG 3′
GADD153-reverse5′ CTGACTGGAATCTGGAGAGTGAGG 3′
RPLP0-forward5′ GAGACAAAGTGGGAGCCAGCGA 3′
RPLP0-reverse5′ ACCCTCCAGGAAGCGAGAATGC 3′