Research Article

Clinical Specimens are the Pool of Multidrug- resistant Pseudomonas aeruginosa Harbouring oprL and toxA Virulence Genes: Findings from a Tertiary Hospital of Nepal

Table 1

Nucleotide sequence of primers and condition used to amplify species-specific virulence genes in P. aeruginosa by PCR.

Virulence factorsTarget genesPrimer namesSequence (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Refs

Exotoxin AtoxAtoxA-fGGTAACCAGCTCAGCCACAT58.2352[34]
toxA-rTGATGTCCAGGTCATGCTTC

Sialidase enzymeoprLoprL-fATGGAAATGCTGAAATTCGGC61.8504[18]
oprL-rCTTCTTCAGCTCGACGCGACG