Table 1: Primer sequences for RT-PCR analysis.

GenePrimer sequences (5′-3′)Annealing temperature (°C)Cycle numbersAmplified products (bp)

ZHX2Sense: GGTAGCGACGAGAACGAG  
Antisense: AGGACTTTGGCACTATGAAC
5834389
NF-YASense: GAGTCTCGGCACCGTCAT  
Antisense: TGCTTCTTCATCGGCTTG
5734117
AFPSense: GTTGCCAACTCAGTGAGGAC  
Antisense: GAGCTTGGCACAGATCCTTA
5928240
GAPDHSense: GCTGAGAACGGGAAGCTTGT  
Antisense: GCCAGGGGTGCTAAGCAGTT
5830299

AFP: alpha-fetoprotein, bp: base pair, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, NF-Y: nuclear factor-Y, and ZHX2: zinc fingers and homeoboxes 2.