Research Article
Lung and Intestine: A Specific Link in an Ulcerative Colitis Rat Model
Table 1
The sequences of the RT-PCR primers and cycling parameters.
| Gene name | Sequence of primers (5′-3′) | Product size (bp) | Cycling parameters |
| iNOS | F: CCTCCTCCACCCTACCAAGT | 199 | 10 min at 95°C; 40 cycles of 30 s at 95°C; 30 s at 60°C; 20 s at 72°C | R: CACCCAAAGTGCTTCAGTCA |
| GAPDH | F: CCATGGAGAAGGCTGGG | 195 | 10 min at 95°C; 40 cycles of 30 s at 95°C; 30 s at 54°C; 20 s at 72°C | R: CAAAGTTGTCATGGATGACC |
|
|