Table 1: PCR primers used to detect CagA, CagE, CagM, CagT, orf10, orf13, TnpA, and TnpB in H. pylori isolates.

GenesPrimersNucleotide sequences (5′–3′)Length of PCR productsLocation in genome of reference

cagA cagA-FGATAACAGGCAAGCTTTTGAGG349
cagA-RCTGCAAAAGATTGTTTGGCAGA 14994–15342
cagE cagE-FGTTACATCAAAAATAAAAGGAAGCG735
cagE-RCAATAATTTTGAAGAGTTTCAAAGC 12342–13076
cagM cagM-FACAAATACAAAAAAGAAAAAGAGGC587
cagM-RATTTTTCAACAAGTTAGAAAAAGCC 4815–9264
cagT cagT-FTCTAAAAAGATTACGCTCATAGGCG490
cagT-RCTTTGGCTTGCATGTTCAAGTTGCC 1182–1671
orf10 orf10-FAATAGTGCTTTCTTTAGGATTAGCG658
orf10-RCCGATTTAATCCTTTCGCTTATGTG 8970–9627
orf13 orf13-FCGTTCATGTTCCATACATCTTTGGC617
orf13-RGATTTATAGCGATCTAAGAAACCGC 704–1320
tnpA tnpA-FATCAGTCCAAAAAGTTTTTTCTTTCC338
tnpA-RTAAGGGGGTATATTTCAACCAACCG 154–541
tnpB tnpB-FCGCTCTCCCTAAATTCAAAGAGGGC578
tnpB-RAGCTAGGGAAAAATCTGTCTATGCC 954–1531

GenBank accession number. AF282853.1.