Table 1: Designed primers sequences used to quantify gene expression by real-time PCR.

ApplicationPrimer nameAccession numberLengthSequence (5′ to 3′)Annealing temperatureLocationProduct size

Overexpressed genes FOXO3-FNM_001455.320ACGGTGTTCGGACCTTCATC60°C1613–1632196 bp
FOXO3-RNM_001455.320TGCTGGCCTGAGACATCAAG1789–1808
GAPDH-FNM_002046.420CGACAGTCAGCCGCATCTTC61°C118–137250 bp
GAPDH-RNM_002046.420CGTTCTCAGCCTTGACGGTG348–367
MYD88-v1-FNM_001172567.120TCATCGAAAAGAGGTTGGCT57°C855–875158 bp
MYD88-v1-RNM_001172567.120GATGGGGATCAGTCGCTTCT993–1012
MYD88-v2-FNM_002468.420CCACACTTGATGACCCCCTG61°C666–685210 bp
MYD88-v2-RNM_002468.420GGCGGCACCTCTTTTCGATG856–875
MYD88-v3-FNM_001172568.120GGGACCCAGCATTGGGCATA61°C538–557289 bp
MYD88-v3-RNM_001172568.120ACCTGGAGAGAGGCTGAGTG807–826
MYD88-v4-FNM_001172569.120CTTGATGACCCCCTGGGTGC62°C671–690207 bp
MYD88-v4-RNM_001172569.120GGTTGGTGTAGTCGCAGACA858–877
MYD88-v5-FNM_001172566.117ACCCAGCATTGGTGCCG60°C541–557202 bp
MYD88-v5-RNM_001172566.120GGTTGGTGTAGTCGCAGACA723–742

Control geneACTB-FNM_001101.321ATGGCCACGGCTGCTTCCAGC60°C763–783322 bp
ACTB-RNM_001101.321CAGGAGGAGCAATGATCTTGA1064–1084

Autophagy-related genesGabarapl1-FNM_031412.220CAGGGTCCCCGTGATTGTAG61°C321–340179 bp
Gabarapl1-RNM_031412.220TGGGAGGGATGGTGTTGTTG480–499
Beclin1-FNM_003766.320GCTGAAGACAGAGCGATGGT59.5°C30–49169 bp
Beclin1-RNM_003766.320CATGGTGCTGTTGTTGGACG179–198
PIK3C3-FNM_002647.220GGCACACAGAGTGAGCAGTA59.5°C2423–2442204 bp
PIK3C3-RNM_002647.220CACAGCCTCTTCATCCGACA 2607–2626
ATG12-FNM_004707.320TGCTGGAGGGGAAGGACTTA59.5°C347–366186 bp
ATG12-RNM_004707.320GTTCGCTCTACTGCCCACTT513–532
MAP1LC3B-FNM_022818.420GCCGCCTTTTTGGGTAGAAG 59.5°C1012–1031225 bp
MAP1LC3B-FNM_022818.420TACCCCTGCAAGAGTGAGGA 1217–1236