Table 1: Sense (S) and antisense (A) sequences of the primers used in the real-time PCR of target and housekeeping genes.

GenePrimer sequence (5′ to 3′)GeneBank
accession number
Amplicon size (base pairs)

ALPSAACCCAGACACAAGCATTCC X13409151
AGAGAGCGAAGGGTCAGTCAG
BSPSGAAAATGGAGACGGCGATAGL20232141
AACCCGAGAGTGTGGAAAGTG
CD44SCTTCCATCTTGACCCGTTGTXM_283773175
AACAGTGCTCCTGTCCCTGAT
Coll-ISAGAGCATGACCGATGGATTCNM_007742177
ACCTTCTTGAGGTTGCCAGTC
Dlx2SAGTTCGTCTCCGGTCAACAANM_010054.1125
AGCCGCCAGCTGGAAACTGGA
Hes1SCTGCAGCGGGCGCAGATGACNM_008235.2114
AACACGTGGACAGGAAGCGGG
IGF-ISGCTCTTCAGTTCGTGTGTGGU75390142
AACATCTCCAGCCTCCTCAGA
IL-6SCCGGGAGCAGTGTGAGCTTANM_031168171
ATAGATGCGTTTGTAGGCGGTC
OPGSAGACCATGAGGTTCCTGCACU94331131
AAAACAGCCCAGTGACCATTC
OsxSACTGGCTAGGTGGTGGTCAG NM_007419135
AGGTAGGGAGCTGGGTTAAGG
RANKLSGGCCACAGCGCTTCTCAG AF019048141
ATGACTTTATGGGAACCCGAT
Smad1SATGCCAGCTGACACACCCCCNM_008539.3112
ATTTCAGCGGGCAGTGGAGGC
Smad5SGGAGTTTGCTCAGCTTCTGGNM_008541.2134
ATGGTGACGTCCTGTCGGTGGT

18S rRNASGTAACCCGTTGAACCCCATT X00686151
ACCATCCAATCGGTAGTAGCG
GAPDHSACCCAGAAGACTGTGGATGGXM_132897171
ACACATTGGGGGTAGGAACAC