Table 1: Primers used and specific parameters of the real-time PCR.

GenePrimer sequenceTmAmplicon size (bp)Primer source

ALPS TGGACCTCGTGGACATCTG7580Oryctolagus cuniculus
A CAGGAGTTCAGTGCGGTTC
ATPaseS CCTGGCTATTGGCTGTTACG77.798Oryctolagus cuniculus
A GCTGGTAGAAGGACACTCTTG
Calcitonin receptorS CGTTCACTCCTGAAAACTACA72.6128Oryctolagus cuniculus
A GCAACCAAGACTAATGAAACA
Collagen IS GGAAACGATGGTGCTACTGG80.483Oryctolagus cuniculus
A CCGACAGCTCCAGGGAAG
IGF-1S CCGACATGCCCAAGACTCA70.381Oryctolagus cuniculus
A TACTTCCTTTCCTTCTCCTCTGA
IL-6S GAGGAAAGAGATGTGTGACCAT73.5104Oryctolagus cuniculus
A AGCATCCGTCTTCTTCTATCAG
IL-10S CCGACTGAGGCTTCCATTCC73.375Oryctolagus cuniculus
A CAGAGGGTAAGAGGGAGCT
OsteocalcinS GCTCAHCCTTCGTGTCCAAG77.870Oryctolagus cuniculus
A CCGTCGATCAGTTGGCGC
Runx2S GCAGTTCCCAAGCATTTCATC72.881Oryctolagus cuniculus
A GTGTAAGTAAAGGTGGCTGGATA
TNF-αS CTCACTACTCCCAGGTTCTCT78.2122Oryctolagus cuniculus
A TTGATGGCAGAGAGGAGGTT
TRAPS GCTACCTCCGCTTCCACTA78.5129Oryctolagus cuniculus
A GCAGCCTGGTCTTGAAGAG
β-actinS CACCCTGATGCTCAAGTACC76.496Oryctolagus cuniculus
A CGCAGCTCGTTGTAGAAGG