Table 1: MLPA probes and results.

Probe nameaSize (bp)ResultsbSequencec
This study[9][10]5′ half probe3′ half probe

IRLAPL1126 CAGCTCTAGCCACTGCCCATCCAGATCTCCGTTCTACCTTTCACA ACACGTACCATTCACAAATGCGTCAGAAACACTACTACG
IGS1093 CTATGCTGCCAGAAGTCTTAGCAA AATGCCACATGTGCCCAAGAGAGATTC
IGS1190 GGAAAATCTCTCTGGGCAGCTGCA GCCACAGTGCAGGTTGCTGACTTC
IGS15117 CACAATTTGGAGCAACTTAAAGAAGATATCAGAAATT TTCTCCAAATTCTGTAGAAAGCACAAATTAAAACAGAG
IGS16102 GTTTTCTAGAGCCATGTATGAGATTGCAGA TGTGAATATTGTTCCAGTGAGAGGATACTG
IGS2899 CTAAATGCTAAAGTAATGGTGCCAGTAA AAGTGACATTGGTAACTTTGGAAACTCTG
IGS2993 GCACTGCGGCCTTCTGACATCAGGTATG ACTCCCTGCCCTGATCTTTCTAC
IGS17114+ GAGTAGATCTCCTTACAGAGAAGCTAGTTGTGGATG TTGTCCCCTTCTTCTTCCTGAATGCATTCCTTCAGG
IGS12111+ GAAGGAATTCTAATATCAGCAGTCTGTGAACA ATGTGAAAATCACTGCCTAAGTCTATTGCAGGCACAG
IGS13117+ GCTTCCCCCTTGGATTCTTTATAGCCAATGCACTTA AAATAGGTTGTTTTGGCACAGCCTGCACAGTTTGATACC
IGS199+ GGAGGAAAGTAGGACAATTTGGAGGA ATTTGGGTTCTCAGTGGGGTGGCATTGTAGG
IGS2117+ GTGTATGATAACTGCGTGTCCTCACTGTGAATAATAGCTTG TGGAACACAAACTGATAGAAATAGACGCATATTG
IGS3111+ CAGCAGCTGGTGAGTGTTCAGCATTAGATATGAGAAGTTA AGCTGAATAAACTGGAGGAAAACCTTCTG
IGS21108++ GTATCAATGATTTGGGGTTCTGTGTTC TATAAGCTACAAGACCTGCCCACCACATATTTACACTTC
IGS2290++ CCCAATTCCTCAGTTACTCACTGG TAGTAAGCTGGACCCTTAGGGAGG
IGS23126++ GAGCATATTTACATGCACCTGGAGGAAGTATCTGATACTATTT CTAAAGATTAAGTAACAGTGCCTCTTCACTCTTGAATCTAG
IGS24120++ CTTATCCAACTAGGCCTTACATAACAAGTAATAGTCTCCAG ATGGAATGGCAAAACAACTCTACCAGTGCACTACATC
IGS2693++ GATTAGACAATGTGGGCAGCTATCT TGGCAACATGACATAATTGGAGCTGC
IGS6117++ GTGGCATAAGGAGCTCACAGCTAGAGTTACT ATCAAAAGCTAGGCAAGCAGAGAAATATTTATGCCACTATAGCC
IGS790++ CTGCTAGATGAGCGCACCTCA ACAGCAAGAGGCTATAGGATGTTCTGC
IGS8102++ CATCCTACATTAGATGATCTCAGTCAACCA CTGACAAAGACTGAAGTTCAAATTCTGATG
IGS9108++ CCCTCAGATGGTAAGCTTCAGAGTTGAGAGACT AAGCCTATAATGGAAAAGTGCTCTTAACTTTGG
MAGEB2-5′96++ GGACTGGCGGATTTGGGTCAGCACGCAT ATTCGTCCCAGGCTGCTAGATACTGC
MAGEB2ex293+++ GGCCACACTTACACCTTCATCGACA AGGTAGACCTCACTGATGAGGAATCC
MAGEB1120+++ GAAGGAAGACAACCCTAGTGGCCACACCTAC ACCCTCGTCAGTAAGCTAAACCTCACCAATGATGGAAACCTGAGCAG
MAGEB1last113+++ GCTAAACCTCACCAATGATGGAAACCTGAGCAATGA TTGGGACTTTCCCAGGAATGGGCTTCTGATGCCTCTCCTGG
DAX1102+++ GCAGCCTCAGCGGGCCTGTTGAAGACGCTG CGCTTCGTCAAGTACTTGCCCTGCTTCCAG
IGS4132+++ CCAAGGAAGTCATAACAGCACAATAGCTATAC AATCTGATAACCTTGTTAGCTCAAATCAAAGCTCCTAACAAGTAGGAGAGGTTAGTGC
CXorf2190+++ CCAGCCACCTGCTCATTATAAGAG GCACAACTCCAGTGGATGTCATTC
GK96+++ CACTATATGTAGGTTATCTCTTCGGTGACA TACACTGCAATTTGAGAGGGCTGG
IGS5114+++ GCAAGCAAGTAAGTGCTGTATCTCCTAGCGAC TCCCTCCATCACCATTCCTGGTACTCTGTTGTCAAATGGC
IGS1496+++ GGCAGAGTCCAATCTATAGCAGAGGAAt CAGCAGCAGTAGAGAGAGTATAAAGC
IGS1899+++ GAGCTGGTGGAGAAACAGTTACAGAAGAT AATGGAAAGCATGGGATCCTGGGAGTGc
IGS19135+++ CCGATACTTGCATGTTGAGATGCCATCCACATTTAGCCATTTAATAC ATAATATTGGTTTAACATTTTATCGAGGAAAGCCTGCCCTAGCACC
IGS3396+++ GGTACTTGGGCCTGGGAAGACTGCAG AATGGGGTTCCTGCATGCAGGCTTCGCC
IGS32120+++ GTTTCTGTGGCAGAGATAGGCATCTTCCATTCCATTGCTGG AGATATGTGGGGCTCCCTCAGAGAAGACTTAGAGACC
IGS31117+++ CATCTGCCTGACATTTAACAAAGCGCATAATGGTTAGC TGATCAATCTGGAGTCCCCACAACTTCATATATCCTC
IGS30111+++ CAGATGTGGATATGCTGGTTTCCAATAGTAAA CATGAATTGCTTTCAGGATTCACATTTAGGTACAAAG
IGS20123++ GATACATGTGACTATGGGTGATTACCTGGCATGTTTG AGCTAAGCCTTTATCACATAATTCACATTTGTAAGGCTCCTCAC
MAP3K7IP3ex12108++ GCTTCTGGTAGTGCTCAAAGTTTCACTTTCAA CCTGGCGCAGACTTTTCTGAATTCAGGTGTACCG
MAP3K7IP3ex11123+ GTGTCATGGATGTCTGCCTGTACTTTGGAGGTCACGCTA ATTCTTCGGGCTTTTCTCTCAATTGTGCAGGGGTCTGAGGAG
TAB3ex10102+ ATGGCTTTTGGATCAAAGTTTCCTATAAA GAAAGTAAATTCATCAGGCATTTAAGAACTC
IGS2799+ GTAATTAGAACAGGAAGAATGGGGGGGAAT AACTTGAGGGAGGGGGTAATTGGCAGC
MAP3K7IP3ex899+ GGGATCGCAGTGGTGCAGCTGACTCTTC TGAGCCGTCTCTGCATCAGGTCATGCTCC
MAP3K7IP3ex7111 CGGCAACAGGCTTCAAGATTGTTGTTATTC TAGGGGAGAAAAATGGTAAAAGTAACATTGGCAACATTC
MAP3K7IP3ex6114 GTGGCCAAGTTTCTCTTAGGAAATGGATGTT AACCGGCTTTCCAAAAGTAATGATCTTCTAGCACCACAGTC
MAP3K7IP3ex1123 GCTTGGACTCTGAGGTTCTGACCGTAGCATCAGATCACACAGAGAAC TACCTTGCTCGCCCGAATGTGTGGCTTTCTCTGC
DMD135 CATCGCTCTGCCCAAATCATCTGCCATGT GGAAAAGACTTCCTACATTGTGTCCTGGAAAACAAAGAGAAAGAAAGACAGACTTTACAAAAGG

aThe probes are listed according to their genetic location from the most telomeric to the most centromeric.
bPlus and minus signs indicate duplicated and nonduplicated regions, respectively.
cThe 5′ half probes are preceded by the universal tag sequence GGGTTCCCTAAGGGTTGGA; the 3′ half-probes are followed by the universal tag sequence TCTAGATTGGATCTTGCTGGCAC and are phosphorylated at the 5′ end.