Table 1: Primers used for PCR Amplification of thyroid peroxidase gene.

Exon Forward Primers Reverse Primers Fragment size (bp) Annealing temperature
Position of 5 end Nucleotide sequence (5→3) Position of 5 end Nucleotide sequence (5→3)

(1)70GACTTCCTAGCATCTTGACG+67CACTTTACAAGTTCCAATGATG22058°C
(2)−74AGACAAGGACACAGCGGTTC+95CATGGCCTTGTCAGTGCTTG22560°C
(3)−67AAGCAACACTGTCAGTGAATC+123TTAACAATGGCAAGCTTCAG27560°C
(4)−60TT AAGTACCAAAGATACCATAGAC+65CACAAAGTCAAGGTGTCCTC29560°C
(5)−101CAAATTCAGATGCTGGAGTCAC+73TCCTTCATGATGGCATCTAGTC30861°C
(6)−86CTGAGAATGGTGTCTTATATCTG+52AGCATCACAGGACCCAATC31361°C
(7)−61GTCATCTTTCTGCTACCACG+60TTGACGTTTTAAATAGCACTTAG32755°C
(8)−60AGAGTCTTACAA AGG GTG CAC+163AAG TAC CTG GGA GAG AGA AGC67860°C
(9)−29TCA CTGAGATGCTTTTCCTAT C+45AAGAGTTCATGGGGACCAG32760°C
(10)−55GTTTCTCTAGAACTGAGCCAAG+79AGTCTCTCTAGCAGCAGGTTG30661°C
(11)−51AACAAAAGTTCAGTTCTGTGAGAG+44TGTGCAGAACGTGAAGGAAG33061°C
(12)−42CTC CAT GCA CTG TGA CCT TAC+57CTTTGTTTGATGAGATGCACG30861°C
(13)−46CTTTTCTCGTAGTTTGACTACATG+54CTTATATCGGAAACATTCAGATG27160°C
(14)−69AGAGAAGCACCTCCCAGAAC+69TACAAAAACTCGCAAATGGAC27061°C
(15)−75CAGACTCAGGCAGGACAACC+69ATTGCAGCCATGTCCAGAG24461°C
(16)−61CTACCCTCCACAGTCACGGT+59CCAGATCCTGTCCAACCACT25062°C
(17)−108TGTGAAAAGAGCTCCTGTC+49GTGATTTTGGGAACATGAAG21162°C