Table 1: Primer pairs and experimental conditions.

Gene productForward and reverse primers (5′-3′)Expected product size, bpAnnealing temperature (°C)

COL2A1CCTAATGGAGATGCTGGTCG187 bp57
CCAGGGAATCCAATGTTGC
COL1A1ATCCAGCTGACCTTCCTGCG322 bp60
TCGAAGCCGAATTCCTGGTCT
Wisp3GTAAGCTTAGCGACATGCAGGGGCTCCTCTT1065 bp62
GCGGATCCTTACAGAATCTTGAGCTCAG
FibronectinGTGTGACCCTCATGAGGCAAC299 bp60
TACTCTCGGGAATCTTCTCTGT
SOX9CACACTACAGCCCCTCCTAC258 bp60
CCTCCTCAAGGTCGAGTGAG
MMP-1ATGCTGAAACCCTGAAGGTG305 bp60
CAAGATTTCCTCCAGGTCCA
-actinTCCTGTGCATCCACGAAACT310 bp58
GAAGCATTTGCGGTGGACGAT