Response of Spatial Patterns of Denitrifying Bacteria Communities to Water Properties in the Stream Inlets at Dianchi Lake, China

Table 2

Primers and thermal profiles used for the qPCR and DGGE.

Target gene	primers	Thermal profile
qPCR	nosZ-F [29]; nosZ1622R [29]	qPCR: 94°C/2 min; 6 cycles of 94°C/30 s, 57°C/30 s (−1°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s.
DGGE	nosZ-F [29]; nosZ1622-GC [30]	DGGE: 94°C/2 min; 10 cycles of 94°C/30 s, 58°C/30 s (−0.5°C/cycle), and 72°C/60 s; 30 cycles of 94°C/30 s, 53°C/30 s, and 72°C/60 s; 72°C/10 min.
qPCR	Cd3aF [31]; R3cd [31]	q-PCR: 94°C/2 min; 6 cycles of 94°C/30 s, 57°C/30 s (−1°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s.
DGGE	Cd3aF [31]; R3cd-GC [32]	DGGE: 94°C/2 min; 10 cycles of 94°C/30 s, 57°C/30 s (−0.5°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s; 72°C/10 min.
qPCR	F1aCu [33]; R3Cu [33]	q-PCR: 95°C/3 min; 6 cycles of 95°C/30 s, 63°C/30 s (−1°C/cycle), and 72°C/30 s; 32 cycles of 95°C/30 s, 58°C/30 s, and 72°C/30 s.
DGGE	F1aCu [33]; R3Cu-GC [33]	DGGE: 95°C/3 min; 32 cycles of 95°C/30 s, 58°C/30 s, and 72°C/45 s; 72°C/10 m.

(GGCGGCGCGCCGCCCGCCCCGCCCCCGTCGCCC) was attached to the 5′ end of the primers.