Table 3: Primer sequences designed and used for mapping HCA1 and HCA2 loci.

Marker nameKind of DNA markerPrimer sequences (5′–3′) Location on IRGSP pseudomolecules Build05
ChromosomePositionSource
FromTo

RM25969SSRFTAAATTTGGTTGTCTACGCATGG11364229364418[23]
RCTGCTCCAGATTAGGAGCCAGredesigned in this study
E30794IndelFTCTGCCTATGTATTTGTGCGTTAAT11679545679744RGP
RAAGTAACACAACGAAGGAGCAACredesigned in this study
S1284IndelFACATTCAACTGATCACAGCC1121861842186392RGP
RAGCTCTGCACTAGGATGATG
RM5599SSRFAATTTTGTGCTGTTGTTGAA1138103543810494[28]
RCTCACAATATCACCATCCAC
S21074IndelFTGCTATAGGTGGTGGTATGC1155888715589049RGP
RTTTCAAGCTGACGAACGATG
RM202SSRFCCAGCAAGCATGTCAATGTA1190505419050718[29]
RCAGATTGGAGATGAAGTCCTCC
RM5731SSRFCCTCCACCCTAAGCTTCTCC111000522210005423[28]
RCGATGCACCTAGCGCATC
RM27404SSRFGCAGCGATTGGAGGTGGAA12204766204863[23]
RGACCGTGCCATCTTGTCCAGredesigned in this study
RM27421SSRFTCAACTCCATTCTACTCTCTACCC12468463468538[23]
RGCTGCTGGTACTTCGTAGAGG
KGS1739IndelFAGAGACGCAGGAGCTGCTTA1219995281999818[14, 30]
RCATGACCCTTCTATGGCAATTAT
RM6296SSRFCCCACGTTTCTCTTGTCCTC1232005803200734[28]
RTCTTGCCTCGCTAGGGTTAG
RM27695SSRFCTATAAAGAGTCCGAGGGGTATTGT1248288654829000[23]
RGGGAGAGGATGTGAATGAAGGredesigned in this study
RZ869 Indel FTTTTGGTATTTGCTGCATGG12 77395077739753 RGP 
RTATCAATCACCCCCAACCTC