Table 2: Sequences used for RT-PCR and real-time RT-PCR.

NameSequence (5′→3′)

PB2 f (BamHI)CTGGATCCATGGAGAGAATAAAAGAACTGAGAGATC
PB2 r (NotI)CTGCGGCCGCCTAATTGATGGCCATCCGAATTC
PB1 f (BamHI)CTGGATCCATGGATGTCAATCCGACTCTACTTTTC
PB1 r (NotI)CTGCGGCCGCTTATTTTTGCCGTCTGAGTTCTTC
PA f (BamHI)GCGGATCCATGGAAGACTTTGTGCGACAATG
PA r (NotI)GCGCGGCCGCCTACTTCAGTGCATGTGTGAGGAAGG
HA f (NheI)GCTAGCCATGAAGGCAATACTAGTAGTTCTGC
HA r (EcoRI)GAATTCTTAAATACATATTCTACACTGTAGAGACCC
NP f (KpnI)GCGGTACCATGGCGTCTCAAGGCACCA
NP r (PstI)ATCTGCAGTCAACTGTCATACTCCTCTGCATTGTC
NA fATGAATCCAAACCAAAAGATAATAACC
NA rTTACTTGTCAATGGTAAATGGCAAC
M fATGAGTCTTCTAACCGAGGTCG
M rTTACTCTAGCTCTATGTTGACAAAATG
NS fATGGACTCCAACACCATGTCAAG
NS rTTAAATAAGCTGAAACGAGAAAGCTCT
HA primer 1GTAAAGCTGGAATCAACAAGG
HA primer 2GAGACCCATTAGAGCACATC
HA probeTET-GATTGCCCCCAGGGAGACTA-BHQ1