Table 1: Primer pairs used to amplify PCR products.

GeneSequence (5′-3′)Product sizeAnnealing T (°C)GeneBank no.

VEGFForward: CAACATCACCATGCAGATTATGC132 bp60°CNM_001033756
Reverse: CCCACAGGGATTTTCTTGTCTT
Flt-1Forward: TGGCTGCGACTCTCTTCTG118 bp60°CNM_002019
Reverse: CAAAGGAACTTCATCTGGGTCC
Flk-1Forward: GGCCCAATAATCAGAGTGGCA104 bp60°CNM_002253
Reverse: TGTCATTTCCGATCACTTTTGGA
GAPDH Forward: CATGAGAAGTATGACAACAGCCT113 bp60°CNM_002046
Reverse: AGTCCTTCCACGATACCAAAGT