Table 1: Oligonucleotide sequences for RT-PCR.

GeneSequence (5 → 3)

ET-15AAGCCCTCCAGAGAGCGTTAT3
5CGAAGGTCTGTCACCAATGT3
6FAM-TGACCCACAACCGAG-GBNFQ

FN-15GATAAATCAACAGTGGGAGC3
5CCCAGATCATGGAGTCTTTA3

VEGF5TCCTCACACCATTGAAACCA3
5GATCCTGCCCTGTCTCTCTG3

β-actin 5CATCGTACTCCTGCTTGCTG3
5CCTCTATGCCAACACAGTGC3