Table 1: Sequences of primers used for real-time RT-PCR amplification.

Target geneGeneBank accession no.a5′-3′ Primer sequencesbProduct length (bp)Tm (°C)

β-actinNM_031144FW: TCGTGCGTGACATTAAAGAG13456
RW: ATTGCCGATAGTGATGACCT
CYP1A2NM_000761FW: GTGGAATCGGTGGCTAAT10554
RW: CACAAAGTCCTTGCTGCTC
CYP2B1NM_001134844FW: GCCTCCTCAATTCCTTCA9953
RW: TGTCTGTCCCACATAGCAT
CYP2B2XM_001062335FW: AGGAGAAGTCGAACCACCAC8256
RW: GAGCAGGAAACCATAGCG
CYP2C6XM_001066767FW: TGTAGAGTTTCAGGGATGG9450
RW: AGCAGTGAGATTGGGAAG
CYP3A2NM_153312FW: GTCTCATAAAGCCCTGTC8147
RW: CTGCTGGTGGTTTCATAG

aGeneBank accession number used to design the primers.
bFW: forward primer; RW: reverse primer.