Table 1: IBV primers for S1 and N genes used in this study.

IBV primerSequence 5′ to 3′Position in S1 sequenceReference

SX1 CACCTAGAGGTTTG T/C T A/T GCAT677 to 698A
SX2 TCCACCTCTATAAACACC C/T TT1148 to 1168[18]
SX3 TAATACTGG C/T AATTTTTCAGA705 to 725
SX4 AATACAGATTGCTTACAACCACC1075 to 1097

Position in N sequence

N784 AATTTTGGTGATGACAAGATGA763 to 784B
N1145 CATTGTTCCTCTCCTCATCTG 1145 to 1165[17]
N791 GTGATGACAAGATGAATGAGGA770 to 791
N1129 CAGCTGAGGTCAATGCTTTATC1129 to 1150

ANucleotide position according to IBV strain 793/B, accession number Z83979.
BNucleotide position according to IBV strain Beaudette, accession number M95169.