Impact of Maize Formulated Herbicides Mesotrione and S-Metolachlor, Applied Alone and in Mixture, on Soil Microbial Communities.

Table 1

PCR primers and amplification programs used in this study.

Target genes and microbial groups	PCR primers	Sequences (5′-3′)	Uses	PCR/amplification program	References
Bacterial-16S rDNA	968f^a	AACGCGAAGAACCTTAC	DGGE 463 bp	5 min. at 95°C, followed by 30 cycles of (1 min. at 95°C, 1 min. at 58°C, 1 min. at 72°C); a final extension step for 7 min. at 72°C	[21]
	1401r	CGGTGTGTACAAGGCCC
Fungal-5,8S rDNA/ITS	ITS5^a	GGAAGTAAAAGTCGTAACAAGG	DGGE 280–600 bp	15 min. at 95°C, followed by 35 cycles of (30 sec. at 95°C, 45 sec. at 55°C, 30 sec. at 72°C); a final extension step for 7 min. at 72°C	[22]
	ITS2	GCTGCGTTCTTCATCGATGC

^aFor DGGE, a GC clamp (5′-CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG G-3′) was attached to 5′ end.