Table 1: Primers used for PCR amplification and sequencing.

GeneRegion and directionPrimer nameSequence (5′-3′)

ITS region5′ end (F)FTCT TTG AAA CCG TAT CGT GA
3′ end (R)RGCT TAT TGA TAT GCT TAA GTT CAG CGG GT
18S rRNA5′ end (F)NS11GTA GTC ATA TGC TTG TCT C
~1150 (R)NS41CTT CCG TCA ATT CCT TTA AG
~1150 (F)NS51AAC TTA AAG GAA TTG ACG GAA G
3′ end (R)NS81TCC GCA GGT TCA CCT ACG GA
5′ end (F)CRN52TGG TTG ATC CTG CCA GTA G
~1137 (R)11372GTG CCC TTC CGT CAA T
~337 (F)AB13GGAGGATTAGGGTCCGATTCC
~1131 (R)TW43CTTCCGTCAATTCCTTTAAG
~1056 (F)MonSGCGGGTGTTTGTTTGA
~1328 (R)MonACTATTTAGCAGGCTGAGGT

1 From White et al. [17], 2 from Booton et al. [18], 3 from Van Oppen [19].