| Genes to be amplified | Primer sequences (5′-3′) | PCR conditions | Expected product size (bp) | References |
| 16S rDNA | 27F: AGAGTTTGATCMTGGCTCAG 152R: AGGAGGTGWTCCARCC | Initiate—95°C, 3 min; 34 cycles of 95°C, 50 s; 60°C, 50 s; 72°C, 1 min; and final extension at 72°C, 90 s. | 1500 | [18] | bla
OXA-23 | bla_oxa-23F: GATCGGATTGGAGAACCAGA bla_oxa-23R: ATTTCTGACCGCATTTCCAT | Initiate—95°C, 5 min; 30 cycles of 94°C, 25 s; 2°C, 40 s; 72°C, 50 s and final extension at 72°C, 6 min. | 501 | [26] | bla
OXA-51 | bla_oxa-51F: TAATGCTTTGATCGGCCTTG bla_oxa-51R: TGGATTGCACTTCATCTTGG | Initiate—95°C, 3 min; 34 cycles of 95°C, 35 s; 57°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90 s. | 353 | [26] | bla
OXA-24 | bla_oxa-24F: GGTTAGTTGGCCCCCTTAAA bla_oxa-24R: AGTTGAGCGAAAAGGGGATT | Initiate—95°C, 5 min; 30 cycles of 94°C, 25 s; 52°C, 40 s; 72°C, 50 s; and final extension at 72°C, 6 min. | 246 | [26] | bla
OXA-58 | bla_oxa-58F: AAGTATTGGGGCTTGTGCTG bla_oxa-58R: CCCCTCTGCGCTCTACATAC | Initiate—95°C, 3 min; 30 cycles of 94°C, 1 min; 55°C, 1 min; 72°C; 1 min; and final extension at 72°C, 5 min. | 599 | [26] | bla
IMP | blaIMP-F: CTACCGCAGCAGAGTCTTTG blaIMP-R: AACCAGTTTTGCCTTACCAT | Initiate—95°C, 5 min; 34 cycles of 94°C, 25 s; 58°C, 40 s; 72°C, 50 s; and final extension at 72°C, 6 min. | 692 | [2] | bla
VIM | blaVIM-F: GTTTGGTCGCATATCGCAAC blaVIM-R: CTACTCAACGACTGAGCCATTTGT | Initiate—95°C, 5 min; 34 cycles of 94°C, 1 min, 58°C, 40 s; 72°C, 50 s; and final extension at 72°C, 6 min. | 643 | [2] | pmrC | pmrC_F: ATGTTTAATCTCATTATAGCCATTTG pmrC_R: TTAGTTTACATGGGCACAAGAGTG | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s, 56°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90. | 1602 | This study | pmrA | pmrA_F: ATGACAAAAATCTTGATGATTGAA pmrA_R: TTATGATTGCCCCAAACGGTA | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s; 56°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90 s. | 675 | This study | pmrB | pmrB_F: GACTGATTTGGGGCACCTC pmrB_R: TGTTTCATGTAAATGTAAAACTTTAGG | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s; 56°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90 s. | 1304 | This study | lpxA | lpxA_F: TGAAGCATTAGCTCAAGTTT lpxA_R: GTCAGCAAATCAATACAAGA | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s; 56°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90 s. | 1179 | [30] | lpxC | lpxC_F: TGAAGATGACGTTCCTGCAA lpxC_R: TGGTGAAAATCAGGCAATGA | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s; 55°C, 35 s; 72°C, 45 s; and final extension at 72°C, 90 s. | 1164 | [30] | lpxD | lpxD_F: CAAAGTATGAATACAACTTTTGAG lpxD_R: GTCAATGGCACATCTGCTAAT | Initiate—95°C, 3 min, 35 cycles of 95°C, 35 s; 55°C, 35 s; 72°C for 45 s; and final extension at 72°C, 90 s. | 1502 | [30] | lpsB | lpsB_F: GCCCGAATTCGCTTCGTATCGCACCAACTC lpsB_R: CCCGGATATCTCAATTCAATACACTTTGATATAGCTC | Initiate—95°C, 3 min; 35 cycles of 95°C, 35 s, 58°C, 35 s, 72°C, 45 s and final extension at 72°C, 90 s. | 1400 | [14] |
|
|