Biomedical Technology and Cell Therapy Research Laboratory, Department of Biomedical Engineering, and Artificial Cells and Organs Research Centre, Faculty of Medicine, McGill University, 3775 University Street, Montreal, PQ, H3A 2B4, Canada
Biotechnology Research Institute (BRI), National Research Council (NRC), 6100 Royalmount Avenue, Montreal, PQ, H4P 2R2, Canada
Abstract
Human interleukin-7 (hIL-7) is a cytokine secreted by the stromal cells of the red marrow. It is important for proliferation during certain stages of B-cell maturation and for T and NK cell survival, development, and homeostasis. It is a critical growth factor for enhancement and recovery of the immune T-cell. Because of its strong immunomodulatory effects, hIL-7 may become a valuable supplementary agent for immunotherapeutical treatments in patients with HIV infection or immunodeficiency. Human IL-7 has previously been produced in various protein expression systems. In this paper, we present an alternative expression system, in Spodoptera frugiperda cells, for the production of hIL-7 using nonlytic vector systems. This system allows generation of correctly translated and accurately processed heterologous proteins as soluble recombinant proteins. Here we report plasmid construction, transfection, and consequent expression of hIL-7 using this nonlytic insect cell expression system. The levels of secreted hIL-7 in a small scale experiment reached a level of 1.7 μg·1−1 under serum-free cell culture conditions.
1. Introduction
Recombinant proteins produced in insect cell systems are useful for fundamental research in
cell and molecular biology. In addition, they are important for commercial
production of reagents, therapeutics, and vaccines for agriculture and human
health applications [1]. To
produce recombinant protein in insect cells, baculovirus expression vector
system (BEVS) is a suitable and widely used eukaryotic system [2–5] for high-level
expression of heterogonous proteins. However, for production and purification
of proteins, this system has a number of disadvantages including the transience
of virus-based expression and the considerable effort required for scale-up and
maintenance of virus stocks. In addition, viral proteases and cell lysates
can cause degradation of the desired proteins and it is difficult to separate
recombinant protein from recombinant virus particles [2, 6]. In
order to resolve these problems, an alternative approach using a nonlytic,
virus-free expression system has been adopted [7, 8] that
uses early baculovirus promoters in either transiently or stably transformed
cells from Drosophila melanogaster, mosquito, as well as Spodoptera cells
[8–11]. In
contrast to baculovirus infected cells, stable insect cells are able to
continuously produce soluble recombinant proteins, which facilitate protein purification [7] and
the proteins are also properly modified. However, the rate of protein
expression in stably transformed cells is often lower than that of a
conventional baculoviral system.
In this study we used a nonlytic system to
produce human IL-7 (hIL-7). Human
IL-7 is a single-chain 25 kDa protein first identified in bone marrow cultures
through its pre-B cell growth factor properties; it was later described as a
potent T-lymphocyte growth factor [12–14]. It is
produced locally by intestinal epithelial and epithelial goblet cells and may
serve as a regulatory factor for intestinal mucosal lymphocytes. IL-7 develops and activates
lymphocytes; it also stimulates lymphopoiesis in lymphopenic mice [15, 16]. These
findings suggest a possible clinical application of IL-7 for accelerating
lymphoid reconstitution in lymphopenic patients. A number of preclinical
studies have demonstrated possible functioning of IL-7 in antitumor clinical
applications and gene therapy for metastatic diseases. IL-7 can also promote engraftment of stem cells in mice
receiving bone marrow transplants, leading to a possible use of hIL-7 in
patients receiving bone marrow or peripheral blood stem cell transplants [12].
To examine the expression and production of hIL-7 in a
nonlytic, baculovirus-free expression system, we used a stably transfected
insect cell system cotransfected with an expression vector containing a silk
moth-Bombyx mori promoter and a
resistance plasmid carrying a selectable marker puromycin gene [7, 17, 18]. For
comparison purposes, we used another plasmid containing OpIE2 promoter
for high-level, constitutive expression of the gene of interest containing a Zeocin
resistance gene for selection of stable cell lines [19, 20]. We
also examined production of hIL-7 in Sf9 insect cells using BEVS.
2. Materials and Methods
2.1. Cells and Media
Spodoptera frugiperda, Sf9 cells (Invitrogen, Carlsbad, Calif, USA)
were cultured in SF-900 II medium (Invitrogen, Carlsbad, Calif, USA)
and incubated in a shaker incubator at a temperature of 27°C and
115 rpm. The cells were maintained by passaging 1 to 2 times weekly at an
initial cell density of 4-
cells·mL−1. During this
process, the total and viable cell densities and the cell size were measured
using the automated Trypan blue exclusion method (Cedex, Innovatis, Bielfeld, Germany).
2.2. Plasmid
Nonlytic
Triple Express Insect Expression System: pIE1/153A (V4) (Cytostore, Calgary, Alberta, Canada) and plasmid pBmA·pac
(Cytostore, Calgary,
Alberta, Canada)
carrying a selectable marker puromycin gene were used.
For comparison the basic vector pIZ/V5-His (Invitrogen, Carlsbad, Calif, USA) was also used.
2.3. Construction of Expression Vector
The hIL-7 gene was amplified by PCR from pORF9-hIL07 transfer vector (InvivoGen, Hornby, Ontario,
Canada) using oligonucleotide primers: Forward: GCCTACCTGGGATCCGGTCAAC and Reverse: TCATCAATGTATGCGGCCGCCTTATCAT-GTCGAG
and Vent polymerase (New England BioLabs, Ipswich, Mass, USA). The PCR
product was subcloned into the BamHII and NotI site of pIE1/153A (V4) vector.
The recombinant plasmids containing hIL-7 cassette in frame were confirmed by
restriction endonuclease digestion and DNA sequencing.
2.4. Cell Culture and Transient Transfection
Sf9 cells were seeded into six-well plates at a density of
cells·mL−1 (2 mL per well). Cells were cotransfected with the plasmids pIE1/153A.hIL-7 and
pBmA·pac or pIZ/V5-His.hIL-7 using Cellfectin
(Invitrogen, Carlsbad, Calif, USA). The mixture was incubated for
45 minutes then added to the cells and incubated for 5 hours at 27°C. The
medium was then replaced with fresh medium (SF900 II) and the cultures further
incubated at 27°C. One week later, transfected cells were transferred to a
medium containing puromycin (Gibco BRL) at a final concentration of 5
g·mL−1 in the case of pIE1/153A.hIL-7 (or 500
g·mL−1 Zeocin in the case of
pIZ/V5-His.hIL-7 transfection) and incubated for 3 weeks. To allow selection of
resistant cells, transfected cells were propagated for a further 2 weeks in
Sf900II supplemented with appropriate antibiotics.
After this initial selection, cell cultures were
maintained in media lacking any antibiotics. To establish clonal cell lines,
the cells were harvested by gentle scraping, aliquots were transferred to
24-well plates and the plates were incubated for seven days at 27°C. The media
were changed every 2 days with fresh media supplemented with an appropriate
antibiotic. Individual colonies were selected and
transferred to 96-well plates using a micropipette. After 5–7 days, cells
were amplified in Sf900II until sufficient cell concentrations were present for
analysis. Polyclonal cell lines were maintained at
27°C in Sf900II. Using a micropipette, ten
to twelve well-isolated antibiotic-resistant
colonies from a 96-well plate were selected, and the hIL-7 expression levels
from the supernatant of each stable polyclone were examined by Western blot
analysis. Cells were maintained in
antibiotic-free medium for 20 passages and the stability of the transfected
cells was monitored using western blots analysis.
2.5. Expression of Recombinant hIL-7 in Stably Transfected Insect Cells
For the expression of recombinant
proteins, a pool of stably transfected Sf9 cloned cells was grown in serum-free medium
(Sf900-II) in shaker flasks. The cells were seeded at a density of
cells·mL−1
and their growth was monitored by taking samples. The total and
viable cell densities as well as cell size were measured (using the automated
Trypan blue exclusion method, Cedex, Innovatis, Bielfeld, Germany).
The experiment was performed in triplicate and samples were taken at regular
intervals. The cell lines were frozen using freezing media (10% FBS, 10% DMSO,
and 80% Sf900 II) and stored in liquid nitrogen for further analysis.
2.6. Production of hIL-7 in Insect Cells Using BEVS
Plasmid construction, bacmid preparation, insect cell transfection, and
baculovirus stock preparation have been described elsewhere [21]. For comparison
assays, recombinant baculovirus containing human interleukin-7 (rbac/hIL-7) was
used at a multiplicity of infection (MOI) between 5 to 0.5 to infect Sf9 cells.
The cells were cultured in shaker flasks and were incubated at 27°C with
agitation at 115 rpm. Samples were taken at regular intervals of 24, 48, 72,
and 96 hours post-infection (hpi). Total and viable cell densities and cell
size were measured using the automated Trypan blue exclusion method (Cedex,
Innovatis, Bielfeld, Germany) during the infection
process. Cell cultures were separated into supernatant and pellets by centrifugation.
2.7. Analytical Sssays
The amount of hIL-7 in supernatants was
measured by sandwich ELISA using rabbit antihuman IL-7 antibody (RDI, Mass,
USA) as the capture antibody and a biotinylated monoclonal antihuman IL-7 (R&D
systems, Ontario, Canada) as the detection antibody. Streptavidin-horseradish
peroxidase (R&D systems, Ontario, Canada) was used for conversion of a substrate
mixture containing stabilized hydrogen peroxide and stabilized
tetramethylbenzidine (R&D systems, Ontario, Canada). The
reactions were terminated by adding
, and the
absorbance was measured at 450 nm using 570 nm as the reference wavelength.
Commercially available purified human IL-7(R&D systems, Ontario, Canada)
was used as a standard.
2.8. Western Blot Analysis
The expression of human interleukin-7 was
determined using sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE). 15
l of samples were loaded to the gel and detected using a
polyclonal rabbit antihuman IL-7 (RDI, Flanders, NJ, USA)
as the primary antibody. The blots were developed using the chemiluminescence
kit (Boehringer Mannheim, Mannheim, Germany) and
visualized with the Kodak manager system.
2.9. hIL-7 Biological Sssay
Recombinant hIL-7 proteins produced in 2
different clones were tested for their bioactivity using induction of in vitro proliferation of an IL-7-dependent
murine immature B lymphocyte cell line 2E8 (ATCC: TIB 239) as a measure of
activity. 2E8 cells were maintained at
37°C in a 5% C
atmosphere in Isocove's modified Dulbecco's medium (ATCC, Manassas, Va, USA)
supplemented with 0.05 mM 2-mercaptoethanol, 2 mM
glutamine, 50 IU/mL penicillin, 50 mg/mL streptomycin, 5 ng/mL IL-7, and 5%
fetal bovine serum (Sigma-Aldrich, Oakville, Ontario,
Canada). IL-7 was found to remain
biologically active in the presence of 0.05 mM 2-mercaptoethanol. Cell
proliferation was detected by tetrazolium compound
[3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium,
inner salt; MTS] and an electron coupling reagent (phenazine methosulfate: PMS)
(Promega, Madison, Wis). For proliferation assays, 2E8 cells were washed three times and seeded at a density of
cells/well in 96-well plates in 50
l of medium containing no IL-7. A 50
l
aliquot of crude protein was added to each well to give a range of
concentrations from 0.01 to 100 ng/mL in a final volume of 100
l. After 72-hours
incubation, a 20-
l aliquot of MTS-PMS (according to the manufacturer's
protocol) was added to each well and incubated at 37°C for 4 hours. MTS is bioreduced by cells into a formazan product that
is soluble in tissue culture medium. The absorbance of the formazan at 490 nm
can be measured directly from 96-well assay plates without additional
processing. Commercially available rhIL-7 preparations were used to
establish the 2E8 Bioassay. Medium alone served as a negative control, and each
sample was assayed in triplicate.
3. Results and Discussion
The hIL-7 gene was obtained by PCR reaction and digestion with NotI and BamHI enzymes
from pORF9-hIL07 transfer vector, which were used to facilitate the insertion
of the gene into the cut pIE1/153A (V4) or pIZ/V5-His expression vector
plasmids. Cloned plasmids were then transferred to competent E.coli cells, purified according to the manufacturer's protocol, and used for
transfection of Sf9 cells. Figure 1 illustrates the construction of pIE1/153A
(V4) expression plasmid carrying hIL-7 gene (pIE1/153A.hIL-7) and the
transfection procedure of the constructed plasmid into the Sf9 insect cells.
For transfection, pIE1/153A.hIL-7 plasmid was cotransfected
with plasmid pBmA.pac containing puromycin
resistance gene into the insect cells. The expression characteristics of
the recombinant hIL-7 protein were analyzed by western blotting using hIL-7
specific antibody, as presented in Figure 2, which shows preliminary results
for screening of positive clones. In Sf9 insect cells, production and
processing of hIL-7 proceeded normally, resulting in a protein with molecular
weight similar to that produced in mammalian cells. The most productive
polyclone (Sf9hIL-7A1) was selected for further study.
Figure 1: Construction of the pIE1/153A (V4) expression plasmid carrying the hIL-7 gene. The
hIL-7 gene from pORF9-hIL07 vector was inserted in pIE1/153A(V4) expression plasmid,
pIE1/153A(V4)/hIL-7 and pBmA-pac were cotransfected into Sf9 cells. Clones producing hIL-7
were selected using puromycin and analyzed by western blot and SDS page.
Figure 2: Screening of puromycin resistant clones in Sf9 cells co-transfected with pIE1/153A (V4)
expression plasmid carrying hIL-7 gene and pBmA-pac carrying puromycin resistance gene. Cells
were placed in medium containing puromycin at a final concentration of 5

gmL
−1 for 3 weeks.
Lane 1: protein marker. Lanes 2–11: polyclones Sf9hIL-7G, Sf9hIL-7E, Sf9hIL-7F, Sf9hIL-7A1,
Sf9hIL-7B4, Sf9hIL-7D5, Sf9hIL-7H, Sf9hIL-7C1-2, Sf9hIL-7C1-3, and Sf9hIL-B4-1, respectively.
Stable expression was verified by
maintaining the Sf9hIL-7A1 polyclone in puromycin-free medium after the
selection. The expression of hIL-7 remained stable during more than 15 cell
passages and cells could be maintained further in selection-free media without
any decrease in their production. The cell
lines were successfully frozen and retrieved from liquid nitrogen using the
same procedures used for Sf9 cells. Figure 3 shows a growth curve over an 11-day period in
Sf900 II for Sf9hIL-7A1 compared to nontransfected Sf9 insect cells. The cells appeared healthy and displayed an average
doubling time of 24 hours. As shown in Figure 3(a), cell densities increased
exponentially over the first six days and then appeared to plateau between days
six to eight, reaching maximum densities of approximately
cells·mL−1. Culture viabilities remained high (above 95%) until day
seven but then dropped to below 70% by day eleven. Culture viabilities
ranged from 95% to 99.5%, with most determinations above 97% during the
exponential stage, which was similar to nontransfected Sf9 insect cells (Figure
3(b)).
Figure 3: Growth curves of the stably transfected Sf9 producing hIL-7 and nontransfected Sf9
insect cells. (a) Viable cell density, total cell density, and viability of stably transfected Sf9
with pIE1/153A (V4)/hIL-7 plasmid. Cells were seeded at a density of

cells
·mL
−1
and maintained at

cells
·mL
−1. (b) Viable cell density, total cell
density, and viability of nontransfected Sf9 insect cells. Cells were seeded at a density
of

cells
·mL
−1 (

).
For comparison, we
cloned the nucleotide sequences corresponding to the hIL-7 protein into the pIZ/V5-His
expression vector and constructed the pIZ/V5-His.hIL-7
vector. This plasmid is an immediate early expression
plasmid where the coding sequence for hIL-7 is positioned under the
transcription control of the OpIE2 promoter. The promoter is derived
from a second immediate early regulatory gene of the baculovirus Orgyia pseudotsugata multicapsid nuclear
polyhedrosis virus (OpMNPV) which was identified in 1992 [20, 22]. Insect cells were then transfected with pIZ/V5-His.hIL-7
and stable transfectants were selected with zeocin, a
glycopeptide antibiotic of the bleomycin family, which is active in vivo against most bacteria
(including E. coli), eukaryotic microorganisms (i.e., yeasts), plant
cells, and animal cells [19]. The
most productive polyclonals, grown with Sf900II
medium in shake flasks at 27°C and 120 rpm from an initial concentration of
cell·mL−1, reached a maximum cell
density of approximately
cell/mL on the fourth
day of culture with a cell viability of 93% (Figure 4(a)). This demonstrated that
stable transfection of pIZ/V5-His.hIL-7 into Sf9 cells did not cause significant changes in the
growth of the transfected Sf9-hIL-7 cells nor in the cell viability, when
compared to growth curves of wild-type Sf9 cells obtained under the same
conditions (Figure 4(b)).
Figure 4: Growth curve of the stably transfected Sf9 producing hIL-7 and nontransfected Sf9
insect cells. (a) Viable cell density, total cell density, and viability of stably transfected Sf9
with pIZ/V5-hIL-7 plasmid. Cells were seeded at a density of

cells
·mL
−1 and maintained at

cells
·mL
−1. (b) Viable cell density, total
cell density, and viability of nontransfected Sf9 insect cells. Cells were seeded at a density
of

cells
·mL
−1 (

).
Secreted
protein was measured in cell culture supernatants collected every 24 hours for
1–11 days (Figure 5) and its concentration was determined by ELISA. The
quantity of hIL-7 in supernatants attained a maximum accumulation of 1.7
g·l−1 of
cell culture supernatant. As shown in Figure 5, production of hIL-7 was
generally still increasing in the supernatant on day 11. In case of the cells
transfected with pIZ/V5-His.hIL-7, production of the recombinant hIL-7 increased to a value of 1
g·l−1 on the eleventh day of culture.
Figure 5: Production profile of hIL-7 in stably transfected Sf9 with two different expressions,
cells were grown in serum-free medium (Sf900-II) in shaker flasks. The amount of hIL-7 in
supernatants was measured by sandwich ELISA using rabbit antihuman IL-7 antibody as the capture
antibody and a monoclonal antihuman IL-7 as the detection antibody. Streptavidin-horseradish
peroxidase was used for conversion of a substrate mixture containing stabilized hydrogen peroxide, and stabilized
tetramethylbenzidine commercially available as purified human IL-7 was used as a standard (

).
Recombinant
hIL-7 produced in both systems was assayed for biological activity by measuring
the stimulation of IL-7-dependent 2E8 cell proliferation in vitro. Maximal
stimulation of proliferation occurred in the presence of hIL-7 and no
difference was seen in the ability of recombinant hIL-7 to induce the
proliferation of cell populations compared with that of the commercially
available purified hIL-7. As shown in Figure 6, incubation with hIL-7 concentrations above 1 ng/mL resulted
in an increase in the A490 nm of 2E8 cell cultures, with no activity
seen at lower hIL-7 concentrations. The bioactivity of the rhIL-7 produced by
both recombinant systems is very similar.
Figure 6: Biological activity assay of recombinant human IL-7 produced in insect cells.
IL-7-dependent murine immature B lymphocyte cell line 2E8 was used for proliferation assay. After 72 hours
incubation at 37
°C in a 5% C

atmosphere, cell proliferation was detected by
tetrazolium compound MTS and an electron coupling reagent PMS. The absorbance of the formazan
was measured at 490 nm. Commercially available rhIL-7 was used to establish the 2E8 bioassay.
Medium alone served as a negative control, and each sample was assayed in triplicate (

).
We
compared productivity of hIL-7 in Sf9 cells using BEVS. To infect cells,
different multiplicity of infection was used. As shown in Figure 7, the final viable cell density of the uninfected cells (control)
was much higher than those of cells
infected by recombinant virus. The number of viable cells increased to more
than
cells/mL by 96 hours in the control and decreased to
less than
cells/mL in cells infected with the virus. In
addition, the viability of infected cells decreased after 48 hpi, to less than 60%. There was no significant difference in
viability between control cells over a period of 96 hpi. The Western blot data
shown in Figure 8 indicate that hIL-7 is produced and processed normally in the
BEVS system to generate a protein with a similar molecular weight to that
produced in mammalian cells. The protein was found in both the supernatant and the cell lysates, however, the intracellular protein was found to have multiple molecular
weights. These different molecular forms are likely a result of incomplete
glycosylation which may occur in this system.
Figure 7: Viable cell density, total cell density and viability of the Sf9 insect cells infected
with different MOI of rbacmid/hIL-7. Different multiplicity of infection (MOI) between 5 to 0.5 was
used. Sf9 cells were cultured in shaker flasks and incubated at 27
°C with agitation at
115 rpm. Samples were taken at regular intervals (24, 48, 72, and 96) hpi. (a), (b), (c) Infected
cells with MOI:5, 1 and 0.5 of the virus stock, respectively. (d) Control (Noninfected
insect cells) (

).
Figure 8: Western blot analysis of the intra- and extracellular of rhIL-7 produced in
Sf9 insect cells. (a) Intracellular protein in Sf9: (lanes 1–3: 24 hpi, using MOI 5,
1 and 0.5 of the virus stock, respectively, lanes 4–6 48 hpi. Lanes 7–9: 72 hpi
and lanes 10–12 96 hpi). (b) Extracellular protein in Sf9: (lanes: 2–4 24 hpi
using MOI 5, 1 and 0.5 virus stock, respectively, lanes: 5–7 48 hpi, lanes: 8–10 72 hpi,
lanes: 11–13 96 hpi).
In general BEVS produced
higher amounts of recombinant hIL-7, as ELISA revealed that the expression
level was almost 10 times greater in BEVS than in the stably transfected insect
cells [21]. For production
of hIL-7 in BEVS, a strong polyhedrin (PH) promoter for high-level
protein expression was used. In this case, the baculovirus can synthesize recombinant protein in infected cells, polyhedrin
eventually constitutes up to 50% of the total protein in the cell. This
promoter has been used to construct expression vectors to allow high level of
expression of the gene of interest under the influence of this promoter. In
contrast, in the case of stably transfected insect cells,
the silk moth-Bombyx mori promoter
was used. This promoter is a region of
the genome of Bombyx mori nuclear polyhedrosis virus (Bm-NPV) containing
the homologous region 3 (HR3), which acts as an enhancer for the promoter of a nonviral
gene, the cytoplasmic actin gene of the silkmoth. On the other hand, stable cultures, initiated with a lower cell density
at
cell/mL, grew until they reached a maximal viable
cell density of
cell/mL; whereas, the cells infected at
cell/mL cell density in case of BEVS reached a
viable cell density of only
cell/mL. Viability of BEVS cells
dropped to 10–20% at 96 hours
post infection while in stably transfected insect cells, viability was
maintained at 80–99% for 240 hours
incubation.
Generally,
BEVS has been used for the high-level expression of eukaryotic genes in insect
cells, as it is a rapid and convenient system for production of many different
foreign proteins. The simplicity and rapidity of the vector system are two of
its most important characters [2, 23], which make BEVS a powerful system for high-level, recombinant protein
expression in insect cells. On the other hand, stable insect expression systems have advantages of both
baculovirus and mammalian expression systems. They are also simple to use, with
uncomplicated techniques for transfection and selection similar to those used
with mammalian expression systems. Stable insect systems often reach higher
levels of expression than do mammalian systems and are especially useful for
production of secreted proteins [7].
In this study, we successfully established stably transfected insect
cell lines for the production of recombinant hIL-7. We have
demonstrated that these stably transfected cells can be used as an alternative to
BEVS for large scale production of recombinant hIL-7. The levels of secreted
human interleukin-7 in our small scale study reached 1.7
g·l−1
under serum-free cell culture conditions (in the case of the pIZ/V5-His.hIL-7
plasmid we obtained 1
g·l−1).
In particular, the stable system using the expression vector pIE1/153A
(V4) constitutes an advance for the expression of hIL-7 and possibly other
glycoproteins in insect cells. This expression plasmid contains a silk
moth-Bombyx mori promoter for high-level expression of the recombinant protein
and a resistance plasmid which carries a selectable marker puromycin gene for
selection of the transfected cells [7]. It
was first constructed by Farrel et al. [7, 18] for
continuous high-level expression of secreted glycoproteins by transformed
lepidopteran insect cells and was developed as an alternative to baculovirus
and mammalian cell expression systems. The expression cassette has the promoter
of the silkmoth cytoplasmic actin gene, to drive expression of foreign gene
sequences and also contains a transactivator gene and enhancer region of BmNPV,
to stimulate gene expression. Since it is a nonlytic system, the glycoproteins
obtained are probably more suitable for structural and functional studies.
Acknowledgments
This work was supported by research grants to
S. Prakash from the Canadian Institute of Health Research (CIHR). The authors
acknowledge Barbara Jardin, Rosa Tran, and Johnny Montes for technical
assistance. M. Mirzaei acknowledges a Ph.D. scholarship from the Iranian
Ministry of Health and Education.
References
- F. Altmann, E. Staudacher, I. B. H. Wilson, and L. März, “Insect cells as hosts for the expression of recombinant glycoproteins,” Glycoconjugate Journal, vol. 16, no. 2, pp. 109–123, 1999.
- L. K. Miller, “Baculoviruses as gene expression vectors,” Annual Review of Microbiology, vol. 42, pp. 177–199, 1988.
- D. J. Fitzgerald, P. Berger, C. Schaffitzel, K. Yamada, T. J. Richmond, and I. Berger, “Protein complex expression by using multigene baculoviral vectors,” Nature Methods, vol. 3, no. 12, pp. 1021–1032, 2006.
- E. Honjo, Y. Shoyama, T. Tamada, et al., “Expression of the extracellular region of the human interleukin-4 receptor chain and interleukin-13 receptor chain by a silkworm-baculovirus system,” Protein Expression and Purification, vol. 60, no. 1, pp. 25–30, 2008.
- H. P. Lesch, S. Turpeinen, E. A. Niskanen, A. J. Mähönen, K. J. Airenne, and S. Ylä-Herttuala, “Generation of lentivirus vectors using recombinant baculoviruses,” Gene Therapy, vol. 15, no. 18, pp. 1280–1286, 2008.
- M. D. Summers, “Milestones leading to the genetic engineering of baculoviruses as expression vector systems and viral pesticides,” Advances in Virus Research, vol. 68, pp. 3–73, 2006.
- P. J. Farrell, M. Lu, J. Prevost, C. Brown, L. Behie, and K. Iatrou, “High-level expression of secreted glycoproteins in transformed lepidopteran insect cells using a novel expression vector,” Biotechnology and Bioengineering, vol. 60, no. 6, pp. 656–663, 1998.
- M. J. Fraser, “Expression of eucaryotic genes in insect cell cultures,” In Vitro Cellular & Developmental Biology—Plant, vol. 25, no. 3, pp. 225–235, 1989.
- J. Benting, S. Lecat, D. Zacchetti, and K. Simons, “Protein expression in Drosophila Schneider cells,” Analytical Biochemistry, vol. 278, no. 1, pp. 59–68, 2000.
- A. R. Bernard, T. A. Kost, L. Overton, et al., “Recombinant protein expression in a Drosophila cell line: comparison with the baculovirus system,” Cytotechnology, vol. 15, no. 1–3, pp. 139–144, 1994.
- T. A. Pfeifer, “Expression of heterologous proteins in stable insect cell culture,” Current Opinion in Biotechnology, vol. 9, no. 5, pp. 518–521, 1998.
- Ö. Alpdogan and M. R. M. van den Brink, “IL-7 and IL-15: therapeutic cytokines for immunodeficiency,” Trends in Immunology, vol. 26, no. 1, pp. 56–64, 2005.
- R. G. Goodwin, S. Lupton, A. Schmierer, et al., “Human interleukin 7: molecular cloning and growth factor activity on human and murine B-lineage cells,” Proceedings of the National Academy of Sciences of the United States of America, vol. 86, no. 1, pp. 302–306, 1989.
- Q. Jiang, W. Q. Li, F. B. Aiello, et al., “Cell biology of IL-7, a key lymphotrophin,” Cytokine & Growth Factor Reviews, vol. 16, no. 4-5, pp. 513–533, 2005.
- P. A. Welch, A. E. Namen, R. G. Goodwin, R. Armitage, and M. D. Cooper, “Human IL-7: a novel T cell growth factor,” The Journal of Immunology, vol. 143, no. 11, pp. 3562–3567, 1989.
- M. B. Widmer, P. J. Morrissey, R. G. Goodwin, et al., “Lymphopoiesis and IL-7,” International Journal of Cell Cloning, vol. 8, pp. 168–170, 1990, discussion 171-172.
- P. J. Farrell, L. A. Behie, and K. Iatrou, “Secretion of cytoplasmic and nuclear proteins from animal cells using novel secretion modules,” Proteins: Structure, Function and Genetics, vol. 41, no. 1, pp. 144–153, 2000.
- P. J. Farrell, L. A. Behie, and K. Iatrou, “Transformed lepidopteran insect cells: new sources of recombinant human tissue plasminogen activator,” Biotechnology and Bioengineering, vol. 64, no. 4, pp. 426–433, 1999.
- T. A. Pfeifer, D. D. Hegedus, T. A. Grigliatti, and D. A. Theilmann, “Baculovirus immediate-early promoter-mediated expression of the resistance gene for use as a dominant selectable marker in Dipteran and Lepidopteran insect cell lines,” Gene, vol. 188, no. 2, pp. 183–190, 1997.
- D. A. Theilmann and S. Stewart, “Molecular analysis of the trans-activating IE-2 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus,” Virology, vol. 187, no. 1, pp. 84–96, 1992.
- M. Mirzaei, B. Jardin, C. B. Elias, and S. Prakash, “Expression and production of human interleukin-7 in insect cells using baculovirus expression vector system (BEVS),” Applied Biochemistry and Biotechnology. In press.
- D. A. Theilmann and S. Stewart, “Tandemly repeated sequence at the end of the IE-2 gene of the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus is an enhancer element,” Virology, vol. 187, no. 1, pp. 97–106, 1992.
- L. K. Miller, “Baculoviruses for foreign gene expression in insect cells,” Biotechnology, vol. 10, pp. 457–465, 1988.